Advanced Search
Last updated date: Dec 16, 2020 Views: 1083 Forks: 0
(modified from: Isolation of Total RNA from Yeast Cell Cultures; Manuel Ares; Cold SpringHarb Protoc; doi: 10.1101/pdb.prot071456)
Materials:
Prep Work:
Place thermomixer in hood at 65°C.
Table1 | |||
Reagent |
Quantity (for 10mL) | Final Concentration | |
1 | Sodium Acetate (NaOAc; 3M; pH 5.5) |
0.167 mL |
50 mM |
2 | EDTA (0.5M, pH 8.0) | 0.2 mL | 10 mM |
3 | Nuclease-Free H2O | 9.633 mL | |
Chill microcentrifuge to 4°C. (all centrifugations should take place at 4°C) Make AE buffer
Thaw Yeast Pellets:
1. Thaw frozen yeast pellets on ice from a turbidostat run. The pellets should contain ~250-500 million yeast cells, corresponding to 25-50mL of spun down haploid yeast turbidostat culture of OD = 1)
Extraction:
Precipitation:
Water Resuspension:
Once the pellet is completely in solution, read the A260, A270, A280, and A320in a spectrophotometer or take a spectrum in a nanospectrophotometer. If the RNA is pure, the A260:A280 ratio should be 1.8–2.2, the A320 (particulates) should be very low, and the A270 should never be higher than the A260 value; otherwise, there is phenol contamination. Expect a yield of 100uL at roughly 5 ug/uL.
Introduction
This protocol is specifically for preparing RNA sequencing libraries from yeast transformed with dual barcoded gRNA libraries, such as: https://benchling.com/s/seq-S5cQupYmmAS5YGu3hWZU or similar dual citrine/mCherry expression cassettes. This plasmid is constructed with 5nt identifiers for both divergent expression cassettes to allow pooling of multiple yeast strains and/or libraries within a single experiment.
Materials
› Yeast Pellets, stored at -80°C or flash frozen
› Hot Phenol Extraction reagents
› See accompanying Total RNA extraction protocol
› Protoscript II reverse transcriptase Kit (NEB #M0368L)
› NEB-next dual indexing primers (NEB #E7600S)
› Primer: RM511: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTtGGTCCAGTCTTGTTACCAGACAACC
› Primer: RM810: ACACTCTTTCCCTACACGACGCTCTTCCGATCT
› Primer: RM812: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTcCGGCGCCTACAACGTCAACATC
› RNAse A (Thermo Scientific #EN0531)
› RNAse H (NEB #M0297S)
› Turbo DNAseI (optional) (Invitrogen #AM2238)
› Zymo RNA clean and concentrate kit (optional) (Zymo #R1017)
› Zymo DNA clean and concentrate kit (Zymo #D4013)
› Q5 polymerase (NEB #M0491L)
› Thermocycler
› Tape Station/Bioanalyzer + necessary Tape reagents
› AMPure XP beads or similar DNA size selection (if necessary, based on results of library prep)
Procedure
Library prep on expressed barcodes
1. Thaw 25-50 mL of frozen pelleted yeast from the turbidostat:
Its good to harvest, pellet, and freeze down (at -80°C) extra yeast so that you have something to go back to in case something in the process fails. For reference, the yeast in the turbidostat should be OD roughly 0.8-1.2 Given that 1mL of OD600 = 10^7 cells, 25 mL (~250 million cells) should be enough to cover a 240,000 barcoded guide library with about 1000x coverage.
2. Refer to the "Total RNA extraction from CiBER-seq yeast pellets" to purify total RNA. As an optional but recommended step, you may treat with Turbo DnaseI according to manufacturer instructions and RNA column clean to get rid of contaminating DNA.
3. Reverse transcribe 4ug of extracted RNA for each sample using protoscript II manufacturer's protocol. (This will be a 4x scaled reverse transcription reaction, since the protocol recommends 1ug of RNA per 20uL reaction) Use oligo dT to perform the RT reaction.
4. Add 0.5uL RNAse A and 0.5uL RNAse H directly to the RT product and incubate for 1 hour at 37°C. (This is important to get rid of RNA that wasn't reverse transcribed, like rRNA and tRNA, since these can compete with column binding) Column clean the reverse-transcribed DNA with the Zymo DNA clean and concentrate kit according to kit instructions using ssDNA 7:1 ratio binding buffer. Elute in nuclease-free water.
5. Use Q5 polymerase according to manufacturer's instructions to PCR amplify a stretch of ~300nt on the cDNA template containing the expressed barcode. This step adds the i7 annealing site for downstream library prep. Use 6 cycles of extension and 1/2 the purified reverse transcription product as template. Save the other 1/2 column- cleaned reverse transcription product to go back to if necessary. Use primers RM511: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTtGGTCCAGTCTTGTTACCAGACAACC and RM810: ACACTCTTTCCCTACACGACGCTCTTCCGATCT for the citrine expression cassette (Tm = 70°C) , or RM812: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTcCGGCGCCTACAACGTCAACATC and RM810:ACACTCTTTCCCTACACGACGCTCTTCCGATCT for the mCherry expression cassette (Tm = 68°C). Use 10 second extension times.
6. Column clean the PCR product according to kit instructions and elute in nuclease-free water.
7. Each round 1 PCR product now has the annealing sites compatible for use with NEB i5/i7 dual index primers. Assign primer pairs to each sample, making sure to choose a set of dual index primers that are compatible for pooled sequencing and will allow the samples to be separated by adapter sequence. Refer to the dual index primer manual for more information. Perform Q5 PCR amplification with 1/2 the column-cleaned product as template and NEB i5/i7 dual index primers according to manufacturer's instructions. Save the other 1/2 column-cleaned product to go back to if necessary. Use annealing temp 72°C, and 10sec extension. Aim for low number of cycles, to avoid overamplification of PCR product. For highly-expressed genes, like those driven by P(PGK1), 6-10 cycles is sufficient, but lower-expressed transcripts may need more cycles.
8. Column clean the PCR product according to kit instructions and elute in nuclease-free water.
9. Run your samples on a Tape Station/Bioanalyzer to determine the concentration and sizing of each amplified barcode library. One sharp peak at the expected amplicon size, ~330bp, indicates a successfully-prepared sample. An additional peak that runs at a high molecular weight may indicate overamplification, as amplicons that melt and re-anneal form bubbles at the mismatched barcode sequence which tend to run slower on the Tape Station. I aim for this over-amplification peak to be <10% the molarity of the ~330bp peak. Over-amplified samples can be re- prepared from the remaining 1/2 round 1 column-cleaned product using fewer PCR cycles. Free primers and primer dimers in the sample should be removed using AMPure XP size selection or similar size selection strategy as they affect the quality of downstream sequencing.
10. Successfully-prepared samples can be pooled and submitted for HiSeq or NovaSeq
Category
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link