tRNA charging measurements

tRNA charging protocol

Day 0: Cell Plating

• Plate 300,000 cells per well of a 6-well plate per condition (I do 4 conditions in singlicates at a time).

Day 1: Cell treatment and harvesting 

• Treat cells with treatments of your choice;
• Put cells on ice and wash with cold PBS;
• Add 1 mL TRIzol on ice, lyse for 5 min;
• Add lysates to eppendorf tubes with 0.2 mL chloroform, shake vigorously 15 sec and let sit on ice for 10 min;
• Spin down for 15 min at 18,600g at 4C;
• Transfer 370 uL of top fraction into new tubes with prealiquotted 2 uL of GlycoBlue (blue glycogen);
• Add 1000 uL cold 100% EtOH, invert several times to mix and incubate in -20C overnight.

Day 2: Cleanup and reprecipitation

• Spin down EtOH-precipitated tRNAs for 30 min at 18600g;
• Remove as much supe as possible (do a quick spin);
• Do not let tubes dry for any extra time as the pellet will not dissolve!
• Add 300 uL of room temp tRNA reprecipitation buffer (0.3M acetate buffer, pH = 4.5, 10 mM EDTA) premixed with 1 uL GlycoBlue;
• Incubate at room temp (~5 min) to ensure the pellet is dissolved;
• Add 810 uL cold EtOH and precipitate in -20C overnight.

Day 3: 3’-OH oxidation and cleanup

• Spin down precipitated samples at 18,600g for 30 min 4C; there will be flaky salt precipitate, but it is ok;
• Wash with 1 mL 80% EtOH;
• Spin down at 18,600g for 10 min 4C, remove supe, air-dry 5 min;
• Resuspend in 35 uL tRNA resuspension buffer (10 mM acetate buffer pH = 4.5, 1 mM EDTA), wait 5 min at RT to dissolve;
• Measure concentration on Nanodrop.
• Set up oxidation reactions in PCR strips: 2 ug of RNA sample in 13.5 uL, 1.5 uL of 1M Na Acetate buffer, pH = 4.5 (final conc ~100 mM), two tubes per sample: one to be oxidized with NaIO₄, one control (NaCl-treated);
• To one aliquot, add 1 uL of NaIO₄ from a 200 mM stock; to another aliquot, add                                                                                                                                                                                                                                                                      1 uL of NaCl from a 200 mM stock, so that the final concentration of each salt is 12.5 mM;
• Incubate at RT for 20 min in the dark;
• Quench by adding 2.2 uL of 2.5M glucose, incubate for 10 min at RT;
• Spike in 1 uL of yeast Phe tRNA (available from Sigma) from 7.3 ng/uL stock in water into each tube (technical control); Note: when preparing the stock, first completely deacylate yeast Phe tRNA in pH= 9 Tris buffer as described in deacylation step below. 
• Perform buffer exchange using GE Healthcare illustra MicroSpin G-50 Columns:
• Note: if using MicroSpin G-25 column, bring the final volume to 100 mL by adding 1 uL NaCl (1M), 8.5 uL Na Acetate  (1M) and 71.3 uL water, before loading onto the column. 
  • Insert the column into the provided collection tube, untwist the cap slightly, twist off the tip.
  • Spin at 720g for 1 min
  • Transfer to eppendorf tubes
  • Apply 250 uL of 200 mM Na Acetate pH = 4.5 buffer and spin at 720g for 1 min
  • Transfer to fresh eppendorf tubes
  • Apply the tRNA sample and spin at 720g for 2 min
• Add a mix of 4.6 uL of 1M Na Acetate pH=4.5 buffer (to 133 mM), 2.3 uL of 1M NaCl (to 66 mM) and 1.5 uL of GlycoBlue to collection tubes prior to spin (8.4 uL total).
• Note: if using G-25 column, add a mix of 13 uL of 1M Na Acetate pH=4.5 buffer ( to 133 mM), 6.6 uL of 1M NaCl (to 66 mM), and 1.5 uL GlycoBlue to collection tubes prior to spin
• Add 2.7x volumes (100 uL for G-50) and (300 uL for G-25) of EtOH and precipitate in -20C overnight.

Day 4: Deacylation

• Spin down precipitated samples at 18,600g for 30 min 4C;
• Resuspend in 100 uL of 50 mM Tris pH = 9.
• Incubate at 37C for 45 min.
• Quench with 100 uL of 50 mM Na Acetate buffer (pH = 4.5) + 100 mM NaCl.
• Add 1.5 uL of GlycoBlue.
• Add 2.7x of EtOH (540 uL) and precipitate in -20C overnight.

Day 5: Ligation and cDNA synthesis

• Spin down precipitated samples at 18,600g for 30 min 4C;
• Resuspend in 10 uL water and measure concentration on NanoDrop;
• Adjust volumes with water so that the concentrations are the same for all samples.

Proceed with RNA-DNA ligation (5 uL rxn):

1. 3’ Adaptor ligation: 

tRNA sample                                              2.3 uL (~200-400 ng)  

5’-adenylated adaptor                           0.5 uL                                          4.5 uL

10x T4 RNA ligase 2 buffer                   0.5 uL                                          4.5 uL

DTT (0.1 M)                                                0.2 uL                                          1.8 uL

DMSO (100%)                                            0.5 uL                                          4.5 uL

 (distribute 1.7 uL into tubes and add 2.3 uL RNA sample)

5’-adenylated adaptor sequence: 5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′

Denature for 30 sec at 90C, ice for 1 min, then add:

RNAse inhibitor                                                                   0.25 uL                      2.25 uL

T4 RNA ligase 2 truncated KQ                                        0.75 uL                      6.75 uL

(distribute 1 uL)

Incubate at RT for 3 hrs.

1. Anneal the RT primer:

GSP (complementary to adaptor, equimolar amount)                                                       5 pmol                      1 uL

Add to samples from step II, 30 sec at 90C, 5 min at 65C, then ice for 1 min.

GSP sequence: GCCTTGGCACCCGAGAATTCCA

1. cDNA synthesis (10 uL rxn):

water                                                                     1 uL                            9 ul

5X SS IV buffer                                                   2 uL                            18 uL

10 mM dNTPs                                                     0.5 uL                        4.5 ul

DTT (0.1 M)                                                         0.5 uL                        4.5 uL

RNase inhibitor                                                  0.5 uL                        4.5 uL

SuperScript RT IV                                              0.5 uL                        4.5 uL

RNA-DNA hybrids from step II                     5 uL                            (distribute 5 uL)

55C for 30 min, 80C for 10 min, 4C.

Dilute reaction with water 1:10 (to 100 uL).

1. qPCR

2x SYBR Green                                           10 uL

Water                                                           7.6 uL

FW Primer (10 mM stock)                    0.2 uL

RV Primer (10 mM stock)                     0.2 uL

cDNA (diluted)                                          2 uL

FW and RV primer pairs (good for mouse and human sequences):

Asparagine

FW GTCTCTGTGGCGCAATCGGT

RV GAGAATTCCATGGCGTCCCTGG

Glutamine

FW GGTTCCATGGTGTAATGGTNAGCACTCTG

RV GAGAATTCCATGGAGGTTCCACCGAGATTTG              

Valine

FW GTTTCCGTAGTGTAGTGGTTATCACGTTCG

RV GAGAATTCCATGGTGTTTCCGCCC

Yeast Phenylalanine

FW GCGGAYTTAGCTCAGTTGGGAGAG

RV GAGAATTCCATGGTGCGAAYTCTGTGG

Adjust the annealing/elongation temperature on the qPCR machine to 63C.

Calculate dCt based on yeast Phe normalization signal, then ddCt = [dCt(NaIO₄-treated)-dCt(NaCl-treated)].