Linear copy and split–based whole-genome amplification

Linear copy and split–based whole-genome amplification (LCS-WGA) protocol

The original paper is published at https://advances.sciencemag.org/content/7/27/eabf3329

All the pipetting tips used in the following procotol are Axygen Dnase and Rnase free and low- binding tips. The preamplification (step 1-3) is conducted in a clean room or PCR work station with positive pressure of HEPA filtered air.

1. Cell lysis:
   1. Cell was lysed in 2 μL of lysis buffer (400 mM KOH, 100 mM DTT, 2 mM EDTA) at 30 °C for 1.5 hours.
   2. 2 μL of stop solution((600 mM Tris-HCl, pH=7.5, UV treated), 400 mM HCl) was added to neutralize the lysis buffer.
   3. After briefly spinning down, the lysed single cells can be stored at -80 °C for future use.
2. UDG treatment
   a. Prepare the UDG reaction buffer as following 
   Reaction mix:
   10X ThermoPol Buffer (New England BioLabs) 1.5 μL 
   DNase-free H₂O (Invitrogen, UV treated) 3.8 μL 
   Uracil-DNA Glycosylase (New England BioLabs) 0.2 μL
   b. Add the 5.5μL UDG buffer into 4 μL single cell lysate from step 1. Incubate the tube on PCR machine at 37 °C for 30 min.
3. Pre-amplification
   a. prepare the dNTP+primer master mix, mix by vortex.
   0.3 μL of dNTP (10mM of each type of dNTP)
   0.38 μL of primer mix (5 mM of GTG AGT GAT GGT TGA GGA TGT GTG GAG NNNNN TTT, 5 mM of GTG AGT GAT GGT TGA GGA TGT GTG GAG NNNNN GGG) (All the oligos are ordered from IDT).
   b. add 0.68 μL pre-Mix to the reaction tube, then gently flick followed by brief centrifugation.
   c. running PCR is as follows: 
   First ramping:
   94 °C for 50 s,
   Pause the PCR machine at 65 °C, add 2.8 U Bst DNA polymerase (large fragment) (New England BioLabs). To quench reaction, quickly add the enzyme and then transfer reaction tubes on ice for 30s or more till you finish all sample tubes. After PCR machine cools down to 10 °C, press next step to resume the PCR program. We use BioRad S1000 PCR machine, which allow you to pause and resume PCR program. 
   Transfer all the PCR tubes back to the PCR block, then run the following ramping steps
   10 °C 40 s →20 °C 40 s →25 °C 40 s →30 °C 40 s →40 °C 1 min →45 °C 1 min→55 °C
   40 s → 65 °C 4 min →94 °C for 20 s → 65 °C Pause
   
   Second ramping:
   Add 2.8 U Bst DNA polymerase (large fragment) and 0.25 μL of 10 mM GAT27 primer (GTG AGT GAT GGT TGA GGA TGT GTG GAG), then run a small number of double strand conversion cycles to convert loopable amplicons to double stranded DNA and eliminate the chance of producing any semi-amplicons from full amplicons.
   
   Start 8 cycles of:
   63 °C 15 s
   65 °C 20 s
   Cycle end,
   65 °C 1 min then pause
   
   Quickly tranfer PCR tubes to quench reaction on ice for 30 s or more and then transfer them back after PCR machine cools down to 10 °C. Next, resume PCR program to the following ramping steps.
   10 °C 40 s →20 °C 40 s →25 °C 40 s →30 °C 40 s →40 °C 1 min → 45 °C 1 min →55 °C 40 s → 65 °C 4 min →94 °C for 20 s → 65 °C and then pause
   
   Third ramping:
   Add 2.8 U Bst DNA polymerase (large fragment).
   Run 8 cycles of doubles strand conversion to convert loopable amplicons to double stranded DNA and eliminate the chance of producing any semi-amplicons from full amplicons.
   
   63 °C 15 s
   65 °C 20 s
   Cycle end, 65 °C 1 min,
   
   Quickly tranfer PCR tubes to quench reaction on ice for 30s or more and put them back after PCR machine cools down to 10 °C, then start the following ramping steps
   
   10 °C 40 s→20 °C 40 s → 25 °C 40 s →30 °C 40 s → 40 °C 1 min → 45 °C 1 min→  55 °C 40 s →65 °C 5 min → 78 °C and then pause to add 4.0μL primer mix ( 0.2 μL 10 mM GAT27 primer and 3.8 μL of H₂O)→94 °C 20 s→ 65 °C and pause
   
   Double strand conversion:
   add 3.6 U Bst DNA polymerase (large fragment) and then run double strand conversion cycles:
   30 cycles of:
   63 °C 15 s
   65 °C 20 s
   Cycle end, 65 °C 2 min,
   72 °C 25 min.
   
   The preamplification products can be temporarily stored at -20 °C for a few days.
   
   d. Yield test (discard the samples without single cells being successfully picked) Reaction mix:
   iTaq Universal SYBR Green Supermix (Bio-rad)    5 μL 
   10 mM GAT27 primer    0.5 μL
   Preamplification products   0.5 μL
   H₂O     μL
   
   Perform the following PCR Program, the CT is expected to be around 13 to 14 on BioRad CFX96 realtime system
   94 °C 2 min, 
   28 cycles of
   94 °C 20 s,
   60 °C 25 s,
   72 °C 2 min 20 s, Cycle end.
   
   Melting curve program can be used to examine the produce size.
    
4. Split-MDA
   a. Briefly vortex the preamplification products and split into three tubes (4.7 μL per tube). Add the following reaction mix 24.6μL
   Reaction mix:
   10X phi29 Buffer (New England BioLabs)  3 μL
   dNTP (10 mM each)    3 μL
   Random hexamer (NNNN*N*N, 1 mM, IDT)   μL
   5% Tween 20 (Sigma)  3 μL
   Bovine Serum Albumin (BSA, 10 mg/mL, New England BioLabs) 0.6 μL 
   H₂O    12 μL
   b. Add 10 U phi29 DNA polymerase (NEB) to the reaction on ice. Incubate on ice for 3 min.
   
   Reaction the following program:
   4 °C 1 min,
   30 °C 10 min (ramping at 0.2 °C/s),
   Pause at 30 °C and using a 10 μL pipet tip to intensively pipetting the reaction for 30-40 times to shear DNA hyperbranched nanoball produced in MDA,
   Incubate on ice for 1 min and cool down the PCR machine to 4 °C, 30 °C 10 min (ramping at 0.2 °C/s),
   Pause at 30 °C and intensively pipetting the reaction for 30-40 times to shear DNA hyperbranched nanoball produced in MDA,
   Incubate on ice for 1 min and cool down the PCR machine to 4 °C, 30 °C 5 min (ramping at 0.2 °C/s), 65 °C 10 min.
   The MDA products were purified with 1X Ampure XP beads and elute into 6.5 μL H₂O.
    
5. Library construction
   a. Tagmentation:
   Add 6.3 mL of 2X Illumina TagmentDNA buffer and 0.2 μL of 10-fold dilutedIllumina TDE1 to each split.
   Incubate the reaction at 55 °C 2 min. Pause at 4 °C and add 1.5 μL of 0.2 M EDTA (Sigma) to stop the tagmentation.
   Then incubate the reaction at 50 °C for 30 min.
   b. Amplification: add the followingreaction mix into 14.5 mL tagmentation reaction from above.
   NEBNext Ultra II Q5 MasterMix  18.7 μL
   0.2 M Mg(Ac)₂      1.5 μL
   10 mM Nextera i5 index primer  1.5 μL
   10 mM Nextera i7 index primer  1.5 μL
   
   Run the following PCR program:
   72 °C 5 min, (this step is required to extenstion on the tagged oligos) 98 °C 30 s,
   12 cycles of:
   98 °C 10 s,
   58 °C 30 s,
   72 °C 1 min, Cycle end, 72 °C 5 min.
   
   Purify with 0.8X Ampure XP beads. Elute into 20 μL H₂O. The libraries are now ready for sequencing. The yield is expected to be around 100 ng for each split amplification. use 1mL to run tape station and examine the libaray size. We expect the libraty size to range from 400 to 500 bp.
    
6. Loci test
   To verify the even amplification, we randomly choose6 loci below to performqPCR based loci test. 5 ng PCR productfrom the last step is used for each locus.Ct value is expected to be around 25. If more than two loci dropout in each split (Ct behind28). we will discard the cell.
   Chr1_F AGGAAAGGCATACTGGAGGGACAT Chr1_R TTAGGGATGGCACCACACTCTTGA Chr2_F TCCCAGAGAAGCATCCTCCATGTT Chr2_R CACCACACTGCCTCAAATGTTGCT Chr4_F ATGGGCAAATCCAGAAGAGTCCAG Chr4_R CCATTCACTTCCTTGGAAAGGTAGCC Chr5_F AATAGCGTGCAGTTCTGGGTAGCA Chr5_R TTCACATCCTGGGAGGAACAGCAT Chr6_F TGAATGCCAGGGTGAGACCTTTGA Chr6_R TGTTCATTATCCCACGCCAGGACT Chr7_F ACCAAAGGAAAGCCAGCCAGTCTA Chr7_R ACTCCACAGCTCCCAAGCATACAA
   The following two-step PCR cycle is used: 94°C 2min,
   35 cycles of: 94°C12s,
   58°C 25s,
   Cycle ends

Category