U2.3 Precursor Small Nuclear RNA in vitro Processing Assay

Materials and Reagents

1. Nylon membrane (Invitrogen, catalog number: LC2003)

2. DNaseI (NEB, catalog number: M0303S)

3. Nuclease-free water (ThermoFisher Scientific, catalog number: AM9932)

4. Trizol (ThermoFisher Scientific, catalog number: 10296028)

5. Chloroform (Sigma-Aldrich, catalog number: 288306)

6. Isopropanol (Sigma-Aldrich, catalog number: 563935)

7. Ethanol (Sigma-Aldrich, catalog number: 51976)

8. 2-mercaptoethanol (Gibco, catalog number: 21985023)

9. Hexylene glycol (Sigma-Aldrich, catalog number: 112100)

10. Triton X-100 (Fisher Scientific, Acros organics, catalog number: 215680010)

11. dNTP (10 mM each) (ThermoFisher Scientific, catalog number: R0192)

12. NTP (10 mM each) (ThermoFisher Scientific, Molecular biology grade NTPs, catalog number: R0481)

13. Glycerol (Sigma-Aldrich, catalog number: G5516)

14. HEPES (Sigma-Aldrich, catalog number: H3375)

15. Various salts: NaCl, KCl, MgCl₂, and MnCl₂ (Sigma-Aldrich, catalog numbers: S9888, P9541, M8266, and M1787, respectively)

16. Creatine phosphate (Sigma-Aldrich, catalog number: 10621714001)

17. Polyvinyl alcohol (Sigma-Aldrich, catalog number: 341584)

18. DTT (ThermoFisher Scientific, catalog number: R0861)

19. Pepstatin A (Sigma-Aldrich, catalog number: P5318)

20. Phenylmethylsulfonyl (PMSF) (Sigma-Aldrich, catalog number: 52332)

21. Protease inhibitor (Roche, catalog number:11697498001)

22. Diethyl pyrocarbonate (DEPC) (Sigma-Aldrich, catalog number: D5758)

23. [γ-³²P]-ATP (3,000 Ci/mmol, 10 mCi/ml) (PerkinElmer, catalog number: BLU002A)

24. T7 RNA polymerase (ThermoFisher, catalog number: 18033019)

25. T4 polynucleotide kinase (PNK) (NEB, catalog number: M0201S)

26. High-fidelity DNA polymerase (ThermoFisher, catalog number: F530L)

27. pCR-Blunt (ThermoFisher, catalog number: K270020)

    A map of pCR-Blunt can be found on the website of the manufacturer: www.thermofisher.com/order/catalog/product/K270020#/K270020.

28. RNA marker (Abnova, catalog number: R0002)

29. Bradford reagent (Bio-Rad, catalog number: 5000205)

30. Gel Purification kit

31. PCR Extraction Kit

32. RNase away

33. Primers:

    U2.3-RNA-F: atacctttctcggccttttggc

    U2.3-RNA-R: ctgcgtaacatatataaatatctctg

    T7-U2.3-F: TAATACGACTCACTATAGGGatacctttctcggc

    PolyG-U2.3-R: CCCCCCCCCCCCctgcgtaacatatataa

34. Processing buffer (see Recipes)

35. M1 buffer (see Recipes)

36. M2 buffer (see Recipes)

37. M3 buffer (see Recipes)

38. 2× formamide loading buffer (see Recipes)

39. 6% denaturing polyacrylamide gel containing 6 M urea (see Recipes)

Equipment

1. PhosphorImager (GE Health Care, model: Typhoon FLA 9500)

2. Suitable space for working with ³²P radioactivity

3. Geiger counter (Thermo, 900 mini)

4. Plexiglass shield to protect user from radioactivity

5. Plexiglass box for ³²P waste

6. Sephadex G-25 spin column (Merck, 11273990001)

7. PCR Machine

8. Phosphor Screen (Molecular Dynamics)

9. Cell strainer (Biofil, catalog number: CSS013100)

10. Vertical electrophoresis gel box and glass plates with spacers and combs (Bio-Rad, model: Mini-PROTEAN Tetra)

11. Spectrophotometer (any UV absorption spectrophotometry including Bradford available)

Software

1. Quantity One (Bio-Rad Laboratories) or ImageJ

Procedure

1. Assemble pre-U2.3 templates

   1. Add the following to the PCR reaction:

      36.5 μl ddH₂O

      10 μl 5× Phusion HF buffer

      1 μl 10 mM dNTP mix

      200 ng DNA of Arabidopsis

      0.5 μl U2.3-RNA-F and U2.3-RNA-R primers (10 pmol/μl)

      0.5 μl High-Fidelity DNA Polymerase

   2. Perform PCR to generate pre-U2.3 fragment with the following cycles:

      98°C for 30 s to denature the DNA

      95°C for 10 s

      58°C for 30 s

      72°C for 15 s

      Repetition of PCR for 31 cycles

      72°C for 10 min

      4°C for storage

   3. Electrophorese PCR-generated DNA fragments in 1.5% agarose gel.

   4. Verify the pre-U2.3 (355 bp) fragment and purify PCR product from agarose gel using Gel Purification kit following manufacturer’s instructions.

   5. Cloning of the amplified PCR products to pCR-Blunt.

      6 μl purified pre-U2.3 PCR product

      1 μl pCR-Blunt vector

      2 μl 5× T4 DNA Ligase buffer

      1 μl T4 DNA Ligase

   6. Incubate the ligation reaction at room temperature for 10 min. Transform the construct into competent Escherichia coli. Extract the positive vector and confirm the pre-U2.3 fragment using singer sequencing.

   7. Assemble pre-U2.3 templates and fuse with T7 promoter and Ploy-G. Add the following to the reaction:

      74 μl ddH₂O

      20 μl 5× Phusion HF buffer

      2 μl 10 mM dNTP mix

      1 μl pre-U2.3 pCR-Blunt vector (50 ng/μl)

      1 μl T7-U2.3-F and PolyG-U2.3-R primers (10 pmol/μl)

      1 μl High-Fidelity DNA Polymerase

      Perform PCR with the following cycles:

      98°C for 30 s to denature the DNA

      95°C for 10 s

      58°C for 30 s

      72°C for 15 s

      Repetition of PCR for 33 cycles

      72°C for 10 min

      4°C for storage

   8. Load a small aliquot of PCR product (5 μl) in 1.5% agarose gel for checking the quality of PCR fragments. If the product contains a single band, the rest of the product (95 μl) can be purified directly using the PCR Extraction Kit without gel purification.

   9. Elute the PCR product in the final 50 μl DEPC water, used as in vitro transcription template.




2. Synthesize pre-U2.3-polyG snRNA substrates

   1. In vitro RNA transcription. Add the following to the reaction:

      22 μl DEPC water

      10 μl 5× Transcription Buffer (Ambion)

      2.5 μl NTPs (10 mM ATP, CTP, UTP, GTP)

      1 μl RNasin (Promega 40 units/μl)

      1 μl 1 M DTT

      5 μl Transcription Template (200 ng/μl)

      1 μl T7 RNA Polymerase (50 unit/μl)

      Incubate for 1 h at 37°C

   2. Add 1 μl of DNase I (10 units/μl) and incubate for 15 min at 37°C.

   3. Add 50 μl 2× formamide loading buffer to the reaction solution, boil for 5 min, and load onto a pre-run 5% denaturing polyacrylamide gel containing 6 M urea. Separate RNAs at 20 mA/gel, ~1 h.

   4. After electrophoresis, visualize the PAGE gel with ethidium bromide and cut out the RNA bands directly with a clean razor blade. The gel slice is crushed into a fine slurry, which is soaked in the TE buffer. The slurry is then centrifuged and the supernatant recovered with a pipette. Polyacrylamide fragments carried over into the supernatant can be removed by filtration through a 0.2 mm filter.

   5. Add 3 M sodium acetate (pH 5.2) to a final concentration of 0.3 M and use 3 volumes of absolute ethanol to precipitate RNA. Pellet the RNA by centrifuging at 12,000 × g for 15 min.

   6. Wash small pellets with 75% ethanol to remove undesired salts.

   7. Dissolve the RNA substrates in 20 μl DEPC water.

   8. Radioactive labeling of RNA substrates. Add the following to the reaction:

      3 μl DEPC H₂O

      20 μl RNA substrate

      3 µl T4 PNK Reaction Buffer (10×)

      1.5 µl T4 PNK

      1.5 μl RNasin (Promega 40 units/µl)

      1 µl [γ-³²P]-ATP

      Incubate at 37°C for 30 min. Add 30 μl DEPC water (This volume can be varied if more or less pre-snRNA probe is desired).

   9. Unincorporated nucleotides are removed using a Sephadex G-25 quick spin column.




3. Synthesize radioactive RNA marker

   1. Take 15 μl commercial RNA marker into Sephadex G-25 column to remove the salt and dye.

   2. For radioactive labeling of the RNA marker, add the following to the reaction:

      10 μl filtered RNA marker

      6 μl DEPC water

      2 µl T4 PNK Reaction Buffer (10×)

      1 µl T4 PNK

      1 µl [γ-³²P]-ATP

      Incubate at 37°C for 30 min

   3. Remove unincorporated nucleotides using a Sephadex G-25 quick spin column.

   4. Prepare a dilution series of the labeled RNA marker (1:5, 1:15, 1:50, and 1:150). Drip 2 µl of series diluted marker and pre-U2.3-polyG RNA substrate onto the nylon membrane. Fix the RNAs spot to the membrane by cross linking using the UV crosslinker with a setting of 120,000 µJ cm^-2.

   5. Place the plastic-wrapped nylon membrane on the storage phosphor imaging screen and expose for 8 h. The phosphor screen is then scanned with PhosphorImager.

   6. Dilute RNA marker using RNA loading buffer to same radiation level with pre-U2.3-polyG RNA substrate according to the radioactive signal of the series dilution spot.




4. In vitro processing assay of pre-U2.3-polyG snRNA

   1. Carefully grind 2 g inflorescence to fine powder in liquid N₂ and pour the powder into 15 ml tube.

   2. Set the tube on ice, add 8 ml M1 buffer, and invert several times.

   3. Filter the solution through cell strainer (100 µM) into a 50 ml tube.

   4. Centrifuge at 12,000 × g for 10 min at 4°C.

   5. Discard the supernatant, add 4 ml M2 buffer, and mix by pipetting. Transfer the solution into a 5 ml tube. Wash with 3 ml M2 buffer and 3 ml M3 buffer, consecutively, each wash by spin 1 min at 13,200 × g. Remove all of the solution with a small tip pipette.

   6. Add 200 μl processing buffer (without creatine phosphate) to suspend the pellet.

   7. Take 10 μl nuclear protein into 190 μl Bradford reagent, let stand for 5 min, and measure the protein concentrations at 595 nm.

   8. Dilute the nuclear protein of each sample to 50 ng/μl using processing buffer (without creatine phosphate).

   9. For a total of 50 μl reaction volume for each repeat, incubate 40 μl of nuclear protein, 5 μl of labeled DNA, and 5 μl of 200 mM creatine phosphate stock solution (20 mM final concentration) at 30°C. (The number of repeats can be varied. We did four repeats here).

   10. Stop reaction by adding 450 μl TRIzol at various time points (we stopped at 10, 30, 60, and 90 min reaction time points). RNAs were extracted following the manufacturer’s instructions.

   11. Dissolve the RNA pellet in 10 μl DEPC water. Add 10 μl formamide loading buffer to the solution and boil for 5 min.

   12. Load half of the RNA extraction, as well as 0.5 μl pre-U2.3 substrate (used as input) and 5 μl RNA marker, onto a pre-run 6% denaturing polyacrylamide gel containing 6 M urea.

   13. Run at 120 V in 1× TBE until the loading dye reaches 2/3 of the gel length.

   14. Remove the gel from the electrophoresis apparatus after electrophoresis. Transfer gel onto plastic wrap carefully. Absorb solution with filter paper. Wrap the gel carefully using plastic wrap.

   15. Place the plastic-wrapped gel on the storage phosphor imaging screen and expose for 6-10 h. The phosphor screen is then scanned with the PhosphorImager.

   16. Export the image of the radioactive signal in the ‘tiff’ format (Figure 1).

       
       

       
       Figure 1. In vitro processing of pre-U2.3-polyG. In vitro transcribed pre-U2.3-polyG RNAs were processed in the nuclear protein extracts from Arabidopsis for various time points, as indicated at the top of the figure. After extraction, RNAs were resolved on a PAGE gel and detected with a PhosphorImager. The position of the pre-U2.3-polyG RNA is indicated by the grey arrow, while the processed mature snRNAs are indicated by the black arrow.

Data analysis

Band intensities were quantified with ImageJ or Quantity One software following these steps (we used Quantity One):

1. Open the gel image using Quantity One.

2. Open the ‘Volume Tools’ and select the ‘Volume Rect Tool.’ Select minimum areas of target bands from the image, including the processed mature snRNA and input (Figure 2).

   
   

   
   Figure 2. The selected frame of target bands in Quantity One software. Successively select the right processed snRNA bands of various reactions (frame 1-4), according to the relevant position of RNA markers and the pre-U2.3-polyG input (frame 5), using the ‘Volume Rect Tool.’




3. Click the ‘Volume Analysis Report’ and select report options including area name, concentration, mean value, and density (Table 1).

   
   

   Table 1. Intensity of relevant bands

Index	Band Name	Volume INT*mm2	Mean Value INT	Density INT/mm2
1	10 min	307.75	33.13	4621.05
2	30 min	476.26	58.59	8173.07
3	60 min	694.97	73.95	10315.99
4	90 min	1095.37	116.56	16259.60
5	Input	829.91	72.58	10125.62




4. Use the value of Density to quantify the relative processing efficiency. The intensities of the radioactive signals of various mature U2.3 were normalized to the input.

Recipes

1. Processing buffer

   10 mM HEPES, pH 7.9

   50 mM KCl

   10% glycerol

   20 mM creatine phosphate

   3 mM MnCl₂

   2.5% Polyvinyl alcohol

   1 mM DTT

   Add PMSF, Pepstatin A, and protease inhibitor just before use.

   Note: Be sure to make the solution on the day of use.

2. M1 buffer

   10 mM Phosphate buffer, pH 7.8

   0.1 M NaCl

   10 mM 2-Mercaptoethanol

   1 M Hexylene glycol

   Add PMSF, Pepstatin A, and protease inhibitor just before use.

3. M2 buffer

   10 mM Phosphate buffer, pH 7.8

   0.1 M NaCl

   10 mM 2-mercaptoethanol

   1 M Hexylene glycol

   10 mM MgCl₂

   Add PMSF, Pepstatin A, and protease inhibitor just before use

4. M3 buffer

   10 mM Phosphate buffer, pH 7.8

   0.1 M NaCl

   10 mM 2-Mercaptoethanol

   Add PMSF, Pepstatin A, and protease inhibitor just before use

5. 2× formamide loading buffer

   95% Deionized formamide

   0.025% (w/v) Bromophenol blue

   0.025% (w/v) Xylene cyanol FF

   5 mM EDTA, pH 8.0

6. 6% denaturing polyacrylamide gel containing 6 M urea (10 ml)

   2 ml 30% polyacrylamide solution (29:1)

   Urea 3.6 g

   1ml 5× TBE

   9.9 ml water

   80 µl 10% APS

   10 µl TEMED

   Before preparing the gel, clean all components with 70% ethanol and RNase away.

Acknowledgments

This work was supported by grants from the State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources (SKLCUSA-a202008).

Competing interests

The authors declare no competing interests.

References

1. Baillat, D., Hakimi, M. A., Naar, A. M., Shilatifard, A., Cooch, N. and Shiekhattar, R. (2005). Integrator, a multiprotein mediator of small nuclear RNA processing, associates with the C-terminal repeat of RNA polymerase II. Cell 123(2): 265-276.
2. Carbon, P., Murgo, S., Ebel, J. P., Krol, A., Tebb, G. and Mattaj, L. W. (1987). A common octamer motif binding protein is involved in the transcription of U6 snRNA by RNA polymerase III and U2 snRNA by RNA polymerase II. Cell 51(1): 71.
3. Chen, J. and Wagner, E. J. (2010). snRNA 3' end formation: the dawn of the Integrator complex. Biochem Soc Trans 38(4): 1082-1087.
4. Hernandez, N. (2001). Small nuclear RNA genes: a model system to study fundamental mechanisms of transcription. J Biol Chem 276(29): 26733-26736.
5. Jawdekar, G. W. and Henry, R. W. (2008). Transcriptional regulation of human small nuclear RNA genes. Biochimica et Biophysica Acta 1779(5): 295-305.
6. Liu, Y., Li, S., Chen, Y., Kimberlin, A. N., Cahoon, E. B. and Yu, B. (2016). snRNA 3’ End Processing by a CPSF73-Containing Complex Essential for Development in Arabidopsis. PLoS Biology 14(10): e1002571.
7. Vankan, P., Filipowicz, W. (1988). Structure of U2 snRNA genes of Arabidopsis thaliana and their expression in electroporated plant protoplasts. EMBO J 7(3): 791.
8. Uguen, P., Murphy, S. (2003). The 3' ends of human pre-snRNAs are produced by RNA polymerase II CTD-dependent RNA processing. EMBO J 22(17): 4544-4554.
9. Uguen, P., Murphy, S. (2004). 3'-box-dependent processing of human pre-U1 snRNA requires a combination of RNA and protein co-factors. Nucleic Acids Res 32(10): 2987-2994.