In situ, Cell-free Protein Expression on Microarrays and Their Use for the Detection of Immune Responses

Materials and Reagents

1. Corning Costar Stripette serological pipettes (Corning, Sigma-Aldrich, catalog number: CLS4488-50EA)
2. Epoxysilane-coated slides (Schott, catalog number: 1066643)
3. Microarray hybridization cassettes (Arrayit Corporation, blue: AHCTZ, green: AHCP, gold: AHCC)
4. ProPlate Slide Modules (Grace Bio-Labs, catalog number: GBL246861-2EA)
5. Standard 96-well PCR plate (Steinbrenner Laborsystem, catalog number: SL-PP96-4L)
6. Microplates, 384-well (Greiner Bio-One, catalog number: 781281)
7. PCR seal (4titude, catalog number: 4ti-0500)
8. quadriPerm chambers (SARSTEDT, catalog number: 94.6077.307)
9. Escherichia coli BL21 wild-type bacteria (GE Healthcare)
10. 6x DNA loading dye (Thermo Scientific, catalog number: R0611)
11. Alexa Fluor 647-conjugated goat anti-human IgA, IgG, IgM (Jackson Immuno Research, catalog number: 109-605-064)
12. Agarose NEEO Ultra-Quality (Carl Roth, catalog number: 2267.4)
13. Betaine monohydrate (Sigma-Aldrich, catalog number: 14300)
14. Bovine serum albumin (Carl Roth, catalog number: 8076.3)
15. Calcium chloride (Carl Roth, catalog number: CN93.2)
16. Deoxynucleotide (dNTP) solution set (New England Biolabs, catalog number: N0446S)
17. Disodium phosphate (Neolab Migge GmbH, catalog number: 4770.1000)
18. DL-Dithiothreitol (DTT) (Thermo Scientific, catalog number: R0861)
19. Ethylenediaminetetraacetic acid (Carl Roth, catalog number: 8043.2)
20. GeneRuler 1 kb DNA Ladder (Thermo Scientific, catalog number: SM0311)
21. Glacial acetic acid (Sigma-Aldrich, catalog number: 695084)
22. Glycine (Gerbu, catalog number: 56406)
23. Nickel(II) sulfate hexahydrate (Sigma-Aldrich, catalog number: 227676)
24. Nitrilotriacetic acid (NTA) (Sigma-Aldrich, catalog number: 72559)
25. Nuclease-free water (Life Technologies, catalog number: AM9922)
26. Monoclonal anti-V5-Cy3 antibody produced in mouse (Sigma-Aldrich, catalog number: V4014-100UG)
27. Monopotassium phosphate (Carl Roth, catalog number: 3904.1)
28. Penta-His Alexa Fluor 647 Conjugate (QIAGEN, catalog number: 35370)
29. peqGreen (VWR, peqLab brand, catalog number: 732-3196)
30. Potassium chloride (Carl Roth, catalog number: 6781.1)
31. Q5 High-Fidelity DNA polymerase, 100 Units, and buffers (New England Biolabs, catalog number: M0491S)
32. S30 T7 High-Yield Protein Expression Kit (Promega, catalog number: L1110)
33. SuperBlock (PBS) blocking buffer (Thermo Scientific, catalog number: 37515)
34. Taq DNA Polymerase (1,000 U) and buffers (QIAGEN, catalog number: 201205) 
35. Tris base (Sigma-Aldrich, catalog number: SLBP5070V)
36. Sodium carbonate (Na₂CO₃) (Carl Roth, catalog number: A135.1)
37. Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888-1KG-M)
38. Sodium hydrogen carbonate (NaHCO₃) (Carl Roth, catalog number: 6885.1)
39. Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 1310-73-2)
40. Tryptone (Sigma-Aldrich, catalog number: T7293-250G)
41. Tween-20 (Sigma-Aldrich, catalog number: P1379)
42. Yeast extract (Sigma-Aldrich, catalog number: Y1625)
43. Complete Protease inhibitor (Roche, catalog number: 04693132001)
44. KH₂PO₄ (Merck, catalog number: 1048711000)
45. MgCl₂ (Carl Roth, catalog number: KK36.1)
46. Acetic acid (Sigma-Aldrich, catalog number: A6283)
47. Glycerol (Sigma-Aldrich, catalog number: G5516)
48. BSA-blocking buffer (see Recipes)
49. NTA-solution (see Recipes)
50. Nickel-solution (see Recipes)
51. LB-medium (see Recipes)
52. Opti-Solution (see Recipes)
53. 10x PBS (see Recipes)
54. PBST (see Recipes)
55. TAE (50x) (see Recipes)
    

Equipment

1. Pipettes (Gilson, PIPETMAN Classic, catalog numbers: F144566, F144057M, F144055M)
2. Slide staining and storage systems (Sigma-Aldrich, catalog number: BAF441800000)
3. Biofuge, Pico (Hereaus Instruments, DJB Labcare 75003235)
4. Magnetic stirrer (IKA, IKAMAG REO)
5. Centrifuge 5810R (Eppendorf, model: 5810R, catalog number: 5811000010)
6. Gel documentation system (Azure C200 Biosystems, catalog number: 170-8195)
7. Homogenizator EmulsiFlex-C5 (AVESTIN, catalog number: 0506394)
8. Laminar hood (Hereaus Instruments, model: LaminAir HB2436)
9. Microcomputer electrophoresis power supply (Consort, model: E835)
10. Mixmate Microplate Mixer (Eppendorf, model: 5353 000.014)
11. NanoDrop spectrophotometer ND-1000 (Thermo Scientific, model: 7934)
12. Nanoplotter 2.0 (GeSIM, model: 060-308)
13. Orbital Shaker Unimay 1010 (Heidolph, model: 543-12310-00)
14. Power Scanner (Tecan, model: 30038387)
15. LifeEco Thermal Cycler (BioER, model: 685115) 
16. Ventilated oven (neoLab, catalog number: 7-9155)
17. 4 °C refrigerator (neoLab, catalog number: 10064)
18. -20 °C freezer (Bosch, model GIV21AF30)
    

Software

1. Fuzznuc (EMBOSS, http://emboss.sourceforge.net/apps/cvs/emboss/apps/fuzznuc.html)
2. Software NPC16 V2.15 (GeSiM, Radeberg, Germany)
3. PowerScanner V1.2 (Tecan Trading AG, Switzerland)
4. GenePix Pro 6.0 (Molecular Devices, Sunnyvale, USA)
5. R Studio (R version 3.3.2, https://www.rstudio.com/)
6. MELTTEMP (http://www.biology.wustl.edu/gcg/melttemp.html)
7. Excel (Microsoft Cooperation, Redmond, USA)
   

Procedure

1. Primers and primer design
   
   1. For the initial PCR, design gene-specific primers in a way that each primer pair is binding at the beginning and end of each ORF and is yielding an in-frame PCR-product. Primer length should be between 16 and 24 nucleotides (nt).
      Note: For primer design, a Perl script can be generated to design primers using the ORF table information text file and fasta sequence(s) of the reference genome.
   2. Calculate the melting temperature of possible primers of different length with MELTTEMP (http://www.biology.wustl.edu/gcg/melttemp.html).
      Note: Other software packages or websites could be used instead. However, this software was found to be useful for calculating melting temperatures of many primers required for whole-proteome projects.
   3. Choose the best fitting primers within a range of the melting temperatures of either 45 °C-55 °C or 55 °C-65 °C.
      Note: Primers used in a single microtiter plate should have a similar melting temperature. If no suitable primers are found that represent the very end of an ORF, consider primer sequences that start one or two triplets downstream of the ATG start codon of the gene of interest.
   4. Check and calculate the uniqueness and the product length of the primers with fuzznuc (EMBOSS, http://emboss.sourceforge.net/apps/cvs/emboss/apps/fuzznuc.html).
      Note: Again, other software packages could be used instead. As before, this package was found to be rather handy in handling a large number of primers.
   5. Add the following 15 nt adaptor sequences to all 5’-ends: forward primers: 5’-atgcaccaaacccaa-3’; reverse primers: 5’-cgcactggcatcatc-3’. 
   6. Primers should be synthesized in 96-well plates for easy handling; we used oligonucleotides produced by the commercial provider biomers.net (Ulm, Germany).
   7. The common primers for the second PCR contain all sequences necessary for transcription and translation [T7 promoter, untranslated region (UTR), ribosome binding site (RBS), start codon (ATG), T7 terminator], fusion peptide tags (N-terminal 6x-His and C-terminal V5 tag) and the sequences complementary to the adaptor sequences common to the gene-specific primers:
      Forward expression primer:
      5’-gaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaagaaggagatatacatatgcatcatcatcatcatcatatgcaccaaacccaa-3’
      Reverse expression primer:
      5’-ctggaattcgcccttttattacgtagaatcgagaccgaggagagggttagggataggcttacccgcactggcatcatc-3'
   
   
2. Polymerase chain reaction
   Perform two successive PCRs for each gene. The first PCR amplifies the gene of interest; the second PCR adds the elements needed for generating expression constructs. For the measurement of DNA concentrations, we use the NanoDrop spectrophotometer, since only small volumes are required. However, any other spectrophotometer could be used instead.
   Note: Concerning the overall reaction, basically all PCR amplifications were successful up to a size of some 3 kb. For larger molecules, the yield varied although the polymerase used was suitable for synthesizing long fragments. 
   
   1. The first PCR is performed using genomic bacterial DNA as template.
      Note: Genomic DNA can be obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ), for example. As already mentioned in the background section above, also cDNA made from RNA preparations, existing ORF-libraries or any other molecule type that can be PCR-amplified could be used as templates.
   2. Perform all PCR in 96-well PCR-plates–one well per gene–and group the genes based on the gene length and the melting temperatures of the respective primer pair.
   3. Use an annealing temperature (T_A) that is 2 °C below the average melting temperature of all primers within each 96-well plate.
   4. Calculate the elongation time (time_E) as listed in the following table: 
      
      
      
   5. Use a PCR thermal cycler to perform the amplification.
   6. Prepare the PCR-mixture for the first PCR as follows: 10.75 µl nuclease-free H₂O, 5.0 µl Q5 High-Fidelity buffer, 5.0 µl Q5 High-Fidelity enhancer, 1.0 µl 10 mM gene-specific forward primer, 1.0 µl 10 mM gene-specific reverse primer, 1.0 µl 10 mM dNTP-mix, 1.0 µl genomic DNA template (2 ng/µl), 0.25 µl Q5 High-Fidelity polymerase.
   7. Use the PCR program listed below, followed by storage at 10 °C: 
      
      
      
   8. Use 1 µl PCR-product of the first PCR as the template for the second PCR; perform the second amplification in 96-well PCR-plates as well.
   9. Store the remaining PCR-product of the first, gene-specific amplification frozen at -20 °C.
   10. Perform the second PCR with the elongation times used for the first PCR.
   11. Prepare the PCR-mixture for the second PCR as follows: 33.5 µl nuclease-free H₂O, 5.0 µl 10x PCR buffer (with 10 mM MgCl₂), 5.0 µl Q-Solution (QIAGEN), 2.0 µl 25 mM MgCl₂, 1.0 µl 10 mM dNTP-mix, 1.0 µl 10 µM forward expression primer, 1.0 µl 10 µM reverse expression primer, 1.0 µl DNA template, 0.5 µl Taq DNA-polymerase (QIAGEN).
       Note: Using a polymerase of low quality could result in incomplete on-chip protein expression and higher background signals at the spots (for example see Figure 1D).
   12. Use the following PCR program: initial denaturation: 95 °C for 5 min; denaturation: 94 °C for 30 s; annealing: 52 °C for 30 s; elongation: 72 °C for calculated time_E; final elongation: 72 °C for 10 min. Repeat denaturation, annealing and elongation 35 times.
   13. Store the PCR-products as they are in the microtiter plate at -20 °C for long-term storage or at 4 °C for short-term storage.
   14. To check the success of all PCRs on a 1.3% agarose gel, dissolve 2.6 g of agarose in 200 ml 1x TAE buffer by heating, add 10 µl peqGreen and pour the gel.
   15. Mix 5 µl of each PCR-product with 1 µl of 6x DNA loading dye and load the mixture onto the gel.
   16. Load at least one lane with the GeneRuler 1 kb ladder as a size standard.
   17. Run the gel with an electrophoresis power supply system at about 150 V and 500 mA for 30 min.
   18. Analyze the gel with UV-light using a gel documentation system. A single band per lane representing a DNA fragment of the expected size indicates a successful PCR.
   
   
3. Generation of Ni-NTA slides
   Note: All steps are performed in a dust-free environment of a sterile hood.
   
   1. Place epoxysilane-coated slides into dust-free slide staining and storage systems.
   2. Prepare NTA-solution by dissolving sodium bicarbonate in sterile-filtered water to a concentration of 2.38 M and add NTA to 0.63 M.
   3. Stir the NTA-solution on a magnetic stirrer at 37 °C for 4 h.
   4. Soak the epoxysilane-coated slides in NTA-solution and incubate them on an orbital shaker set to 50 rpm at room temperature overnight.
   5. Discard the NTA-solution and wash the slides twice with sterile-filtered water for 5 min on an orbital shaker set to 50 rpm.
   6. Rinse slides in sterile-filtered water and dry them with compressed air.
   7. Incubate slides in 1% nickel sulfate solution at room temperature for 6 h.
   8. Rinse slides in sterile-filtered water.
   9. Incubate slides in Opti-solution containing 0.2 M acetic acid, 0.2 M CaCl₂ and 0.1% Tween-20 at room temperature for 30 min.
   10. Rinse slides four times in sterile-filtered water and dry them with compressed air.
   11. Store slides in manufacturer’s storage boxes at 4 °C for a maximum of 3 months.
   
   
4. Spotting of protein microarrays
   Before each spotting procedure, the Nanoplotter 2.0 has to be washed twice with ddH₂O for at least 20 min.
   
   1. Transfer 45 µl each of all final PCR-products into 384-well plates.
   2. Add 5 µl 5 M betaine to each well and mix plates using a microplate mixer; centrifuge all plates at about 400 x g for 1 min to collect the entire volume at the bottom.
   3. Place up to 33 Ni-NTA-coated slides onto the slide tablet of the Nanoplotter.
   4. Design a work plate within the Nanoplotter software, containing information about the microarray pattern: number of rows and columns, distance between spots, spot distance to edges of the slide, number and distance of blocks as well as information about the type of the 384-well plate.
   5. Measure Z-values (vertical axis) for every slide individually to maintain proper spotting distance.
   6. Write a transfer file compatible to the work plate in Excel and transfer it to Nanoplotter Notepad.
   7. Transfer per spot 0.6 nl of each PCR-product onto the Ni-NTA slides.
      Note: Confirm correct sample delivery by using the automated detection with a stroboscope system that is part of the Nanoplotter.
   8. Prepare S30 T7 High-Yield Protein Expression Kit by mixing immediately before use the ingredients provided by the manufacturer: 20 µl S30 Premix Plus, 18 µl T7 S30 Extract and 12 µl nuclease-free water.
   9. Transfer the 50 µl expression mixture to a new well of a 384-well microplate.
      Note: Avoid air bubbles while handling the expression mixture.
   10. Dispense with the Nanoplotter 2.4 nl expression mixture directly on top of each spot of a expression construct.
       Note: Transfer the expression mixture slide by slide. One piezo element of the spotter can produce a maximum of 800 spots using one sample uptake. If necessary, use multiple piezo elements for spotting the expression mixture or multiple sample uptakes per slide.
   11. Place the slide immediately into a microarray hybridization cassette containing 30 µl of nuclease-free water in each reservoir.
   12. Incubate the hybridization cassette in a preheated box containing wet tissue paper at 37 °C for 1 h.
   13. Transfer the cassettes into a ventilated oven and incubate at 30 °C overnight.
   14. Store slides without loss of reactivity at -20 °C for a maximum of 3 months.
   
   
5. Determination of on-chip protein expression by antibody staining
   Note: To avoid drying, perform all subsequent steps immediately after one another. All washing and incubation steps are performed at room temperature unless stated otherwise on an orbital shaker set to 50 rpm.
   
   1. Take slides from the freezer and place them into ProPlate Slide Modules.
   2. Block each slide with 2 ml BSA-blocking-buffer for 1 h.
   3. Dilute fluorophore-conjugated antibodies directed against the protein tags (Penta-His Alexa Fluor 647 conjugate; monoclonal Anti-V5-Cy3 antibody) 1:1,000 in BSA-blocking-buffer and incubate the mixture at 4 °C for 1 h.
   4. Discard blocking buffer and wash slides twice with 2 ml PBST each for 5 min.
   5. Incubate each slide with 1 ml of the antibody solution for 1 h. 
   6. Remove slides from the ProPlate Slide Modules, place them into quadriPerm chambers and wash three times with 5 ml PBST each for 10 min.
   7. Rinse slides in sterile-filtered water and air-dry them in a ventilated oven at 30 °C by using slide staining and storage systems.
   8. Scan slides in a Power Scanner at excitation wavelengths of 532 nm and 635 nm.
   
   
6. Proteome immunoassay
   Note: To avoid drying, perform all subsequent steps immediately after one another. All washing and incubation steps are performed at room temperature unless stated otherwise on an orbital shaker set to 50 rpm.
   
   1. Take slides from freezer and place them into ProPlate Slide Modules.
   2. Block each slide with 2 ml SuperBlock blocking buffer for 1 h.
   3. Prepare patient serum samples by diluting sera 1:33 in SuperBlock blocking buffer also containing 1 µg/µl E. coli wild-type lysate and incubate mixture at 4 °C for 1 h.
   4. Discard blocking buffer and wash each slide twice with 2 ml PBST for 5 min.
   5. Discard PBST and incubate slide with 1.5 ml serum dilution for 1 h. 
   6. Prepare a 1:350 dilution of the secondary antibody (Alexa Fluor 647-conjugated goat anti-human IgA, IgG, IgM) in SuperBlock blocking buffer and incubate the dilution at 4 °C for 1 h.
   7. Wash each slide twice with 2 ml PBST for 5 min 
   8. Incubate slide with 1.5 ml of the 1:350 dilution of the secondary antibody for 1 h. 
   9. Remove slide from the ProPlate Slide Modules, place it into a quadriPerm chamber and wash three times with 5 ml PBST each for 10 min.
   10. Rinse slide in sterile-filtered water and air-dry it in a ventilated oven at 30 °C by using slide staining and storage systems.
   11. Scan slide with a Power Scanner at 635 nm excitation wavelength (Figure 1).
   
   Note: E. coli lysate can be produced using the following protocol.
   
   12. Inoculate 200 ml LB-medium with E. coli BL21 wild-type and incubate the medium at 37 °C overnight on an orbital shaker set to 150 rpm.
       
   13. Centrifuge bacteria suspension at 3,000 x g at 4 °C for 10 min.
   14. Discard the supernatant and resuspend pellet in 10 ml PBS (this suspension can be stored at -20 °C).
   15. Add 2 mM DTT and 500 µl Complete Protease inhibitor to the 10 ml bacteria suspension.
   16. Lyse bacteria with a homogenizer.
   17. Centrifuge lysate at 22,000 x g at 4 °C for 30 min.
   18. Take supernatant and determine protein concentration.
   19. Mix cleared lysate with water-free glycerol at a ratio of 1:1.
   20. Store lysate at -20 °C.

Data analysis

The acquisition and analysis software GenePix Pro 6.0 is used to generate from the scanner images gpr-files containing the mean fluorescence intensity (MFI) values for each processed slide. The gpr-files are analyzed using the statistical programming language R.
  For determination of the degree of on-chip protein expression by antibodies targeting the terminal 6xHis- or V5-tag, respectively, the acquired gpr-files are imported to R and each protein spot’s MFI is compared to the MFI values of the negative control spots (made from control PCR lacking DNA-template). A protein is considered to be expressed if its final MFI (either 6xHis or V5 signal) exceeds the mean MFI value of the control spots plus five standard deviations.
  For analysis of proteome immunoassays, the acquired gpr-files of all relevant microarray experiments are imported into R, and a threshold is defined as mean MFI of all negative controls plus five standard deviations. Before moving on to marker selection, visual quality control is done to all scanned slides for identification of possible artifacts. In addition, each slide’s MFI values are plotted according to their position on the slide. This allows the recognition of technical effects on individual slides, like gradients of the background or of the MFI values. All antigens showing MFI values above threshold are considered to be reactive with antibodies of the respective patient serum sample. In order to allow comparisons between different slides, an MFI signal is calculated by:

MFI signal = (MFI of antigen)/(MFI of threshold)

An MFI signal > 1 indicates a significant reactivity with a certain antigen.

Recipes

1. BSA-blocking buffer
   2% BSA in PBST
2. NTA-solution
   90 g nitrilotriacetic acid
   150 g NaHCO₃
   Add ddH₂O to 750 ml
3. Nickel-solution
   Dissolve 10 g NiSO₄ in 1,000 ml ddH₂O
4. LB-medium
   10 g Tryptone
   5 g NaCl
   5 g Yeast extract
   Add 800 ml of ddH₂O
   Adjust pH to 7.4 with NaOH
   Add ddH₂O to 1,000 ml and autoclave
5. Opti-Solution
   22.4 g CaCl₂
   12 ml glacial acetic acid
   1 ml Tween-20
   Add ddH₂O to 1,000 ml
6. 10x PBS
   80 g NaCl
   2 g KH₂PO₄
   11.1 g Na₂HPO₄
   2 g KCl
   Add ddH₂O to 1,000 ml
7. PBST
   100 ml 10x PBS
   5 ml 10% Tween-20
   Add ddH₂O to 1,000 ml
8. TAE (50x)
   242 g Tris base
   57.1 ml glacial acetic acid
   100 ml 0.5 M EDTA
   Add ddH₂O to 1,000 ml
   Dilute to 1x before use
   

Acknowledgments

During early stages, work was supported by the European Union, as part of the Affinomics consortium and the PaCaNet project funded by the German Federal Ministry of Education and Research (BMBF).

Competing interests

The authors declare no conflicts of interest or competing interests.

References

1. Angenendt, P., Kreutzberger, J., Glokler, J. and Hoheisel, J. D. (2006). Generation of high density protein microarrays by cell-free in situ expression of unpurified PCR products. Mol Cell Proteomics 5(9): 1658-1666.
2. He, M. and Taussig, M. J. (2001). Single step generation of protein arrays from DNA by cell-free expression and in situ immobilisation (PISA method). Nucleic Acids Res 29(15): E73-73.
3. He, M., Stoevesandt, O., Palmer, E. A., Khan, F., Ericsson, O. and Taussig, M. J. (2008). Printing protein arrays from DNA arrays. Nat Methods 5(2): 175-177.
4. Hufnagel, K., Lueong, S., Willhauck-Fleckenstein, M., Hotz-Wagenblatt, A., Miao, B., Bauer, A., Michel, A., Butt, J., Pawlita, M., Hoheisel, J. D. and Waterboer, T. (2018). Immunoprofiling of Chlamydia trachomatis using whole-proteome microarrays generated by on-chip in situ expression. Sci Rep 8(1): 7503.
5. Ramachandran, N., Hainsworth, E., Bhullar, B., Eisenstein, S., Rosen, B., Lau, A. Y., Walter, J. C. and LaBaer, J. (2004). Self-assembling protein microarrays. Science 305(5680): 86-90.
6. Syafrizayanti, Lueong, S. S., Di, C., Schaefer, J. V., Pluckthun, A. and Hoheisel, J. D. (2017). Personalised proteome analysis by means of protein microarrays made from individual patient samples. Sci Rep 7: 39756.
7. The ORFeome Collaboration. (2016). The ORFeome Collaboration: a genome-scale human ORF-clone resource. Nat Methods 13(3): 191-192.