Published: Vol 5, Iss 2, Jan 20, 2015 DOI: 10.21769/BioProtoc.1377 Views: 9118
Reviewed by: Vanesa Olivares-IllanaPia GiovannelliAnonymous reviewer(s)

Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
Related protocols

Protocol for Quantifying γH2AX Foci in Irradiated Cells Using Immunofluorescence and Fiji Software
Lu Deng [...] Lingying Wu
Aug 20, 2025 2552 Views

Colocalizing Telomeres With PML or γH2AX Foci by IF-FISH in Mouse Brain Neurons
Anna Konopka
Nov 5, 2025 1547 Views

A Quantitative DNA Fiber Assay to Monitor Replication Fork Progression, Protection, and Restart
Debanjali Bhattacharya and Ganesh Nagaraju
Feb 5, 2026 352 Views
Abstract
Drug-induced mitochondrial injury can be caused by many different mechanisms including inhibition of mitochondrial DNA replication, transcription, translation, and altered protein function. Determination of the level of mitochondrial DNA relative to the nuclear DNA levels provides important information on potential mitochondrial toxicity.
Keywords: Mitochondrial toxicityMaterials and Reagents
Equipment
Procedure
| Primer/probe name | Oligonucleotide sequence | Concentration in qPCR |
| Cytochrome b forward | CCTTCCACCCTTACTACACAATCAA | 0.9 μM |
| Cytochrome b reverse | GGTCTGGTGAGAATAGTGTTAATGTCA | 0.9 μM |
| Cytochrome b probe | FAM-ACGCCCTCGGCTTAC-BHQ1 | 0.2 μM |
| Amount of total cellular DNA (ng/reaction) | CT Valuea | ΔCT Value | |
| Cytochome b | β-actin | ||
| 5 | 15.7 ± 0.4 | 22.2 ± 0.3 | -6.6 ± 0.1 |
| 10 | 17.3 ± 0.4 | 23.9 ± 0.3 | -6.7 ± 0.1 |
| 20 | 18.8 ± 0.3 | 25.7 ± 0.3 | -6.9 ± 0.1 |
| 40 | 20.3 ± 0.4 | 27.3 ± 0.3 | -7.0 ± 0.1 |
| Compound | Concentration (μM) | Relative amount of mtDNA (% mtDNA)a | p-value compared to DMSO (control)b |
| DMSO (control) | - | 100.0 ± 8.8 | - |
| ddC | 0.2 | 57.0 ± 10.4 | < 0.0001 |
| 2.0 | 25.1 ± 7.8 | < 0.0001 | |
| 20 | 6.9 ± 2.9 | < 0.0001 |
Recipes
Acknowledgments
All of the work was sponsored by Gilead Sciences, Inc. This protocol was adapted from Feng et al. (2014).
References
Article Information
Copyright
© 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Perron, M. and Feng, J. Y. (2015). Determination of Mitochondrial DNA Upon Drug Treatment. Bio-protocol 5(2): e1377. DOI: 10.21769/BioProtoc.1377.
Category
Molecular Biology > DNA > DNA damage and repair
Molecular Biology > DNA > DNA quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link
