Materials and Reagents

Note: All reagents can be stored at room temperature unless otherwise specified.

1. Construction of the donor strain

   1. B. subtilis 168 (Mori et al., 2022)

   2. B. subtilis YNB211 (Mori et al., 2022)

   3. G. kaustophilus MK244 (Mori et al., 2022)

   4. pUCG18T (Mori et al., 2022)

   5. LB medium (2% agar) (BD Difco, catalog number: 240230)

   6. 10% SDS (Nacalai Tesque, catalog number: 30562-04)

   7. Lysozyme (Wako, catalog number: 129-06723)

   8. Phenol/Chloroform/Isoamyl alcohol (25:24:1) (Wako, catalog number: 311-90151), store at 4 °C

   9. 70% Ethanol

   10. 99.5% Ethanol

   11. KOD -Plus- Neo polymerase (Toyobo, catalog number: KOD-401), store at -20 °C

   12. Agarose for electrophoresis gel (ME, Nacalai Tesque, catalog number: 01133-24)

   13. In silico Molecular Cloning software for designing PCR primers (In Silico Biology, Inc., catalog number: IMCGF01)

   14. Primer pairs used for the PCR reaction of five fragments

       1. Fragment A1:

          aprE-U-f1 ccggtacttgccaccacatcataac

          aprE-U-r cagtaacctcatcaagccaagctacctctcgctatttccgtagagactcg

       2. Fragment A2:

          aprE-D-f2 gacagaggaattagatacattcgcgttaatcaacgtacaagcagctgcac

          aprE-D-r ggccgagcagtattcgaatgtcaag

       3. Fragment B1:

          degA-U-f gtagcttggcttgatgaggttactg

          degA-U-r2 catcggtcataaaatccgtatccttggttactttcatcgctcatcattc

       4. Fragment B2:

          degA-D-f2 ctgcaaggcgattaagttgggtaacagtgaaatcgtaaggatgtgagcag

          degA-D-r cgcgaatgtatctaattcctctgtc

       5. Fragment C1:

          kan-f aaggatacggattttatgaccgatg

          kan-r2 gttacccaacttaatcgccttgcag

   15. Primers used for the recombinant PCR reactions that ligate the five fragments.

       1. aprE-U-f3-nested caccgagctcatagcttgtcgcgatcacctcatcc

       2. aprE-D-r2-nested tgctttcgctgattacaacattggtgacgctgcct

   16. DNA purification kit (Wizard^® SV Gel and PCR Clean-Up System, Promega, catalog number: A9281)

   17. 7.5 mg/mL Kanamycin sulfate stock solution in water (Wako, catalog number: 113-00343)

   18. Solution A (see Recipes)

   19. Solution B (see Recipes)

   20. 100× Trace element (see Recipes)

   21. TKE buffer (see Recipes)

   22. 50× TAE buffer (see Recipes)

   23. C-1 and C-2 medium for transformation (see Recipes)

       
       

2. Conjugation and selection of transconjugant (transformant)

   1. 7.5 mg/mL Kanamycin sulfate stock solution in water (Wako, catalog number: 113-00343)

   2. 10 mg/mL Chloramphenicol stock solution in 70% ethanol (Wako, catalog number: 030-19452)

   3. 100 mM IPTG stock solution in water (Nacalai Tesque, catalog number: 367-93-1)

   4. LB medium (see Recipes)

   5. LBMSM medium (see Recipes)

      
      

3. Southern blotting analysis

   1. Primers used for amplification of a template DNA for synthesizing RNA probe

      1. Km-probe-f taatacgactcactatagggtatggctctcttggtcgtc

      2. Km-probe-r tctgattccacctgagatgc

   2. Agarose for electrophoresis gel (SP, Nacalai Tesque, catalog number: 01163-76)

   3. DNA Molecular Weight Marker II, DIG-labeled (Roche, catalog number: 11218590910)

   4. DNA purification kit (Wizard^® SV Gel and PCR Clean-Up System, Promega, catalog number: A9281)

   5. T7 RNA polymerase (Roche, catalog number: 10881767001), store at -20 °C

   6. DIG RNA Labeling Mix, 10× conc. (Roche, catalog number: 11277073910), store at -20 °C

   7. Restriction enzymes

      1. Cla I (Takara, catalog number: 1034A), store at -20 °C

      2. Sac II (Takara, catalog number: 1079A), store at -20 °C

   8. DIG Easy Hyb (Roche, catalog number: 11603558001), store at 4 °C

   9. Amersham Hybond-N+ (GE Healthcare, catalog number: RPN82B)

   10. Hybridization bag (Hybridization Bags Hybri-Bag Hard, COSMO BIO, catalog number: S-1001)

   11. Blocking Reagent (Roche, catalog number: 11096176001)

   12. Anti-Digoxigenin-AP, Fab fragment (Roche, catalog number: 11093274910), store at 4 °C

   13. CSPD, ready-to-use (Roche, number: 11755633001), store at 4 °C

   14. 20× SSC buffer (see Recipes)

   15. Maleic acid buffer (see Recipes)

   16. Denaturing solution (see Recipes)

   17. Neutralizing solution (see Recipes)

   18. High-stringency wash solution (see Recipes)

   19. Low-stringency wash solution (see Recipes)

   20. Detection buffer (see Recipes)

Equipment

1. Construction of the donor strain

   1. Thermal cycler (for example, Takara Bio, Thermal Cycler Dice Touch TP350, or equivalent)

   2. Centrifuge (for example, TOMY, MX-307, or equivalent)

   3. Spectrophotometer (for example, GE Healthcare, NanoVue Plus, or equivalent)

   4. Agarose gel electrophoresis apparatus (for example, Takara Bio, Mupid^®-2plus, or equivalent)

   5. Incubator (for example, PHCbi, MIR-H163, or equivalent)

      
      

2. Conjugation and selection of transconjugant (transformant)

   1. Two incubator shakers, one set at 37 °C and the other at 60 °C (TAITEC, Bioshaker BR-43FM-MR, or equivalent)

   2. Centrifuge (TOMY, MX-307, or equivalent)

   3. Two incubators, one is set at 37 °C and the other 60 °C (PHCbi, MIR-H163, or equivalents)

   4. Spectrophotometer (SHIMADZU, UV-1800, or equivalent)

   5. 300 mL baffled Erlenmeyer flask

      
      

3. Southern blotting (or: Southern blot analysis)

   1. Thermal cycler (Takara Bio, Thermal Cycler Dice Touch TP350, or equivalent)

   2. Spectrophotometer (GE Healthcare, NanoVue Plus, or equivalent)

   3. Agarose gel electrophoresis apparatus (Bio-Rad, Sub-Cell GT Cell, or equivalent)

   4. Transfer apparatus (Bio Craft, Vacuum Transfer BS-31, or equivalent)

   5. UV crosslinker (UVP, CL-1000, or equivalent)

   6. Shaker (Bio Craft, Labo Shaker BC-730, or equivalent)

   7. Chemiluminescence imager (Bio-Rad, ChemiDoc XRS+, or equivalent)

Procedure