Materials and Reagents

Prepare all buffers and solutions using ultrapure, nuclease free-water and analytical grade reagents. Filter with 0.2 µm filter at least once and store at 4°C or -20°C. Always use nuclease-free tubes and cotton-filter tips.

1. Black bottom plates [black bottom plate 96 well, polypropylene, flat bottom (Chimney well)] are necessary for the fluorescence assay to reduce background and crosstalk, and to absorb light (Greiner Bio-One, catalog number: 655209)

2. Streptavidin (Pierce, catalog number: PIER21122)

   Streptavidin (SA) has a great affinity to biotin triethyleneglycol (BITEG). Oligonucleotides with this modification on 3′, 5′, or both ends are protected from nuclease activity after adding 2 μl (0.02 mg/ml) streptavidin to the reaction mix. Prepare 1 mg/ml in ultrapure water.

3. Oligonucleotides

   Order lyophilised unmodified HPLC-purified oligonucleotide substrates and biotin or BITEG modified HPLC-purified oligonucleotides (Integrated DNA Technologies). Dilute them in 1× Annealing Buffer (Sigma-Aldrich) for DNA substrates (100 μM stock) and siMAX^TM dilution buffer (Eurofins; 30 mM HEPES, 100 mM KCl, 1 mM MgCl₂, pH = 7.3) for all RNA substrates.

   Note: Modified DNA or RNA bases can be ordered in the synthesised oligos. We have done so successfully in the past to measure the effect of base modifications on enzymatic functions.

   
   

   Oligonucleotides from our library were designed and optimised against secondary structure formation using the ‘Predict a Secondary Structure Web Server’ (https://rna.urmc.rochester.edu/RNAstructureWeb/Servers/Predict1/Predict1.html).

   The basic 80bp sequences are as follows:

   Forward: GATGGTTTGTTGGTCTATTACTACTTGGAGCTTGTATGATTCGAAACCTTGGAGTACTTGCCTACTTGGAGTGAACTTAG

   Reverse: CTAAGTTCACTCCAAGTAGGCAAGTACTCCAAGGTTTCGAATCATACAAGCTCCAAGTAGTAATAGACCAACAAACCATC

   
   

   For designing all types of library oligomers, the basic oligonucleotide sequence can be shortened from both ends or split into two molecules to produce gaps or nicks in duplex DNA. Single nucleotides can be exchanged to add mismatches, substrate preferences, and so forth (Figures 1 and 2).

   
   

   
   Figure 1. For the calibration curve, two example sets are presented, with and without streptavidin blockade on ends. These need to match the DNA substrates used in the experiment.

   
   

   
   Figure 2. Set of 80-mer oligonucleotide substrates

   
   

4. Nucleases

   Perform the calibration of the method using the commercial nucleases with known activity and preferably acting in a similar mechanism to the predicted activity of the enzyme to be tested. For example, to test the removal of 5′ mononucleotides from duplex DNA, use Exonuclease T7 (T7, New England Biolabs, catalog number: M0263S). For nucleases acting 3′ to 5′, use Exonuclease III (ExoIII, Thermo Scientific, catalog number: EN0191) (Figure 3).

   
   

   
   Figure 3. Scheme of PG release from dsDNA after nuclease treatment (ExoIII)

   
   

5. 1 M Tris, pH 7.5-8.0 (ThermoScientific, catalog number: 15567027)

6. 5 M NaCl, RNase-free (ThermoScientific, catalog number: AM9759)

7. 0.5 M EDTA pH 8.0 (ThermoScientific, catalog number: 15575020)

8. 10× Tango Buffer (ThermoScientific, catalog number: BY5)

9. CutSmart (New England Biolabs, catalog number: B7204S)

10. Glycerol (ThermoScientific, catalog number: 15514011)

11. Quant-iT^TM PicoGreen^TM dsDNA Assay Kit (Invitrogen, catalog number: P7589)

12. Quant-iT^TM microRNA Assay Kit (Invitrogen, catalog number: Q33140)

13. Annealing Buffer Composition (1×) (see Recipes)

14. Storage buffers (see Recipes)

15. Reaction buffers (see Recipes)

16. Divalent cations (see Recipes)

17. PG buffer (see Recipes)

18. Nucleic acid dyes (see Recipes)

Equipment

1. Plate reader (Tecan or BMG)

   Select the appropriate measurement parameters (temperature, wavelength, number of flashes, and settle time) for your assay.

     Preheat the microplate reader to the optimal temperature for enzyme activity (commonly 37°C). To slow down the reaction, set to a lower temperature (e.g., 20°C). Use the wavelength 483-15 nm for excitation (483 nm is the middle excitation peak with a bandwidth of 15 nm; i.e., the excitation range is 475-490 nm) and 530-30 nm for emission (530 nm is the middle emission peak with a bandwidth of 30 nm; i.e., the emission range is 515-545 nm). Increase the number of flashes per well until noise of BLANK wells does not improve further or until measurement time per well becomes unacceptable. Depending on the enzyme, read the samples every 45-60 s for 15 min to 2 h with a shake before each read.

     Photobleaching occurring in the samples causes the fluorescence signal to decrease with time. Therefore, run a control curve run in every experiment simultaneously with samples to measure this effect. Longer readings can be inaccurate due to total photobleaching of PicoGreen to the level of the background.

     We tested Infinite M Plex (TECAN) and CLARIOstar (BMG Labtech) plate readers. The nuclease assay can also be performed in the qPCR reader, but we found that the plate reader gives consistent results and offers more options, such as shaking the plate before a read.

     While the best practices regarding reads per well vary with each enzyme, in general, an optimal duration of reads is approximately 1 h. If using a CLARIOstar, factor the whole time needed to read the entire plate, well by well, which for a full plate took approximately 48 s. So, each well could only be read every 50 s. If the plate reader permits it, try to use bidirectional reading row by row, and add the enzymes in the same order.

Procedure