Materials and Reagents

Note: This protocol was established and tested during the Ebola virus outbreak in West Africa in January 2015, using materials and reagents available at that time. As the development of the MinION platform progresses rapidly, some modifications might be necessary to adopt the protocol to the materials and reagents available now. Particularly, while at the time the technology was only available to members of the MinION access program, it is now commercially available.

1. 0.2 ml PCR-tubes (ideally in strips of 8) (e.g., Thermo Fisher Scientific, Thermo Scientific^TM, catalog number: AB0490 )
   
2. 1.5 ml tubes (e.g., Thermo Fisher Scientific, Fisher Scientific, catalog number: S348903 )
   
3. Eppendorf protein LoBind tubes, 1.5 ml, PCR clean (Eppendorf, catalog number: 0030108116 )
   
4. Gloves
   
5. MinION flowcell, revision 7.3 (Oxford Nanopore Technologies [ONT])
   
6. RNA freshly purified (or stored at -80 °C) from patient blood samples following appropriate safety protocols
   
7. SuperScript III First-Strand-Synthesis System (Thermo Fisher Scientific, Invitrogen^TM, catalog number: 18080051 )
   
8. DEPC-treated nuclease-free water (e.g., Thermo Fisher Scientific, Ambion^TM, catalog number: AM9906 )
   
9. Primer, 10 μM (see Table 1 for sequences); primer CGGACACACAAAAAGAAAGAAG at a concentration of 2 μM and 10 μM
   
10. dNTP mix, 10 mM each (e.g., New England Biolabs, catalog number: N0447S )
    
11. iProof^TM high-fidelity polymerase (Bio-Rad Laboratories, catalog number: 1725301 )
    
12. Agencourt AMPure XP beads (Beckman Coulter, catalog number: A63881 )
    
13. His-Tag dynabeads (Thermo Fisher Scientific, Novex^TM, catalog number: 10103D )
    
14. Magnetic stand for PCR-purification with Agencourt AMPure XP beads in 1.5 ml tubes (e.g., Beckman Coulter, catalog number: A29182 )
    
15. 70% ethanol
    
16. Qiagen elution buffer (QIAGEN, catalog number: 19086 )
    
17. 50x TAE buffer (ideally in 10.2 ml aliquots) (e.g., Thermo Fisher Scientific, Thermo Scientific^TM, catalog number: B49 )*
    
18. Agarose (ideally in pre-weighed aliquots of 0.5 g) (e.g., Thermo Fisher Scientific, Invitrogen^TM, catalog number: 16500100 )*
    
19. DNA standard (e.g., New England Biolabs, catalog number: N3200S )*
    
20. 6x gel loading dye (e.g., New England Biolabs, catalog number: B7022S )*
    
21. Fast Blast DNA stain (Bio-Rad Laboratories, catalog number: 1660420 )*
    
22. NEBNext dA-tailing module (New England Biolabs, catalog number: E6053S )
    
23. NEBNext end repair module (New England Biolabs, catalog number: E6050S )
    
24. Blunt/TA ligase master mix (New England Biolabs, catalog number: M0367L )
    
25. Genomic DNA Sequencing Kit SQK-MAP004 (ONT): contains DNA CS, 2x wash buffer, elution buffer, EP buffer, HP adapter, Adapter mix and Fuel mix
    

*Note: Optional materials and reagents.

Equipment

1. MinION sequencing device (ONT)
   
2. PCR cycler (e.g., Thermo Fisher Scientific, Applied Biosystems^TM, catalog number: A24811 )
   
3. Vortexer (e.g., Thermo Fisher Scientific, Fisher Scientific, catalog number: S96461A )
   
4. Mini centrifuges for 1.5 and 0.2 ml tubes (e.g., VWR, catalog number: 93000-204 )
   
5. Pipettes: 10 μl, 20 μl, 100 μl, 1,000 μl, 8 x 20 μl multichannel with filter tips (e.g., Mettler-Toledo, catalog numbers: PR-10 , PR-20 , PR-100 , PR-1000 , L8-20XLS+ )
   
6. Racks for 0.2 ml PCR tubes and 1.5 ml tubes (e.g., Thermo Fisher Scientific, Fisher Scientific, catalog numbers: 05-541-85 , 05-541-2 )
   
7. PCR cooler rack, 0.2 ml, 4 °C (e.g., Eppendorf, catalog number: 3881000031 )
   
8. Styrofoam box with lid and cold packs (frozen cold pack at bottom, 4 °C cold pack on top, then sample rack on top of that) as cooler box (or alternatively ice box, when ice is available)
   
9. Electrophoresis chamber with power supply (e.g., Mupid-exU, Takara Clontech)*
   
10. Microwave oven*
    
11. Agarose gel casting stand, or alternatively laboratory tape*
    
12. 250-300 ml glass flask for preparing agarose*
    
13. Box for agarose gel staining*
    
14. Additional infrastructure when sequencing under outbreak conditions
    Note: This infrastructure is a given in any Western laboratory, but should be considered when establishing the method under field conditions in outbreak areas. While this topic cannot be exhaustively covered in this protocol, the following points should be carefully considered.
    
    1. Power generator, uninterruptable power supplies, voltage regulators (all depending on the quality of the electricity supply).
       
    2. Air conditioning if possible, alternatively external heatsink (e.g., a ~30 x 30 cm metal plate) for MinION sequencing device.
       
    3. Clean water for preparation of 1x TAE, and for DNA staining and destaining - bottled drinking water (ideally in 500 ml bottles) can be used for this purpose if no other source of clean water is available.
       
    4. Equipment for safe sample inactivation and RNA extraction.
       
    5. 4 °C fridge, -20 °C freezer, optionally -80 °C freezer for storage of RNA.
       
    6. Personal protective equipment as deemed necessary.
    *Note: Optional equipment.
    

Software

1. Laptop running MinKNOW software v 0.48.2.12 (ONT) with internet connection (e.g., via 3G wireless router); for current IT requirements please check the ONT internet site (https://nanoporetech.com/community/faqs).

Procedure