Materials and Reagents

1. Extraction of HBV DNA from patient serum samples
   
   1. 1.5 ml microfuge tube (Axygen, catalog number: 17615044 )
      
   2. Patient serum samples
      
   3. Tris phenol (Beijing Shuang Xiang Da Company, catalog number: 108952 )
      
   4. Trichloromethane (Sinopharm Chemical Reagent Co., catalog number: 61553 )
      
   5. Ethanol (Sinopharm Chemical Reagent Co., catalog number: 32061 )
      
   6. Isopropyl alcohol (Sinopharm Chemical Reagent Co., catalog number: 32064 )
      
   7. Yeast RNA (Life Technologies, Ambion^®, catalog number: AM7118 )
      Note: Currently, it is “Thermo Fisher Scientific, Ambion^TM, catalog number: AM7118”.
      
   8. Sodium acetate trihydrate (NaOAc) (Sigma-Aldrich, catalog number: 236500 )
      
   9. Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: EDS )
      
   10. Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
       
   11. Tris-base (Sigma-Aldrich, catalog number: T1378 )
       
   12. Viral lysis buffer (see Recipes)
       
   
   
2. Amplification of HBV DNA by Polymerase Chain Reaction (PCR)
   
   1. KOD-PLUS: a high-fidelity DNA polymerase (TOYOBO CO., catalog number: KOD201 )
      
   2. Primers used for PCR as described below (Detailed description can refer to Figure 1)
      
      

      Name	Type	Sequence 5’-3’	Position of 5’-base
      P1	forward	CCGGCGTCGACGAGCTCTTCT TTTTCACCTCTGCCTAATCA	1821
      P2	forward	CCGGCGTCGACGAGCTCTTCA AAAAGTTGCATGGTGCTGG	1825
      P3	reverse	CACTGAACAAATGGCACTAGT AAACTGAGCC	699
      P4	reverse	GGCTCAGTTTACTAGTGCCATT TGTTCAGTG	669

      
      Note: The underlined red letters are the restriction endonuclease binding site. P1: Sal I, Sac I; P2: Sal I, Sac I; P3: Spe I; P4: Spe I. P1/P3 are used to amplify the 2.05 kb fragment (1,821-699 bp), P2/P4 are used to amplify the 1.15 kb fragment (669-1,825 bp).
   
   
3. Gel extraction of HBV DNA
   
   1. AxyPrep^TM DNA Gel Extraction kit (Thermo Fisher Scientific, Axygen^TM, catalog number: APGX50 )
   
   
4. Add dATP to generate 3’ overhangs
   
   1. Taq DNA polymerase (TOYOBO CO., catalog number: TAP201 )
      
   2. dATP (Thermo Fisher Scientific, Thermo Scientific^TM, catalog number: R0141 )
   
   
5. Integration of HBV DNA into pGEM^®-T Vector
   
   1. pGEM^®-T Vector System I (Promega Corporation, catalog number: A3600 )
      
   2. 0.5 ml microfuge tube (Axygen, catalog number: 05615119 )
   
   
6. Transformation
   
   1. Competent DH5α (Takara, catalog number: 9057 )
      
   2. Ampicillin (Sinopharm Chemical Reagent Co., catalog number: 69523 )
      
   3. Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Sigma-Aldrich, catalog number: PHG0010-5G )
      
   4. 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal) (Sigma-Aldrich, catalog number: B4252-50MG )
      
   5. Sodium chloride (NaCl) (Sinopharm Chemical Reagent CO., catalog number: 10019318 )
      
   6. TRYPTONE (Oxoid Limited, catalog number: LP0042 )
      
   7. YEAST EXTRACT (Oxoid Limited, catalog number: LP0021 )
      
   8. LB medium (see Recipes)
   
   
7. Extract HBV DNA-integrated plasmid from E.coli-DH5α
   
   1. E.Z.N.A.^® Plasmid DNA Mini Kit I (Omega Bio-tek Inc., catalog number: D6942-02 )
   
   
8. Integration of full-length HBV genome into the cloning vector pUC19
   
   1. Sac I (New England Biolabs, catalog number: R0156S )
      
   2. Sal I (New England Biolabs, catalog number: R0138S )
      
   3. Spe I (New England Biolabs, catalog number: R0133S )
      
   4. T4 DNA ligase (New England Biolabs, catalog number: M0202S )

Equipment

1. Instrument for PCR (Biocompare, Biometra, catalog number: 070851 )
   
2. Centrifuge (Eppendorf, model: 5424 )
   
3. Electrophoresis system (Beijing Liuyi Biotechnology, model: DYY6C )
   
4. Electronic scales (Mettler-Toledo International Inc., model: PB602-N )
   Note: Currently, it is “Mettler-Toledo International Inc., model: PB602-S ”.
   
5. Bacteriological incubator (bio-equip, Shanghai Jing Hong Laboratory Instrument Co., model number: GNP-9080 )
   
6. BIO IMAGING SYSTEM (Syngene, model: SYDR2/1361 )
   
7. Heat block
   

Procedure