Published: Vol 2, Iss 6, Mar 20, 2012 DOI: 10.21769/BioProtoc.128 Views: 25999

Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
Related protocols

Detection of piggyBac-mediated Transposition by Splinkerette PCR in Transgenic Lines of Strongyloides ratti
Hongguang Shao and James B. Lok
Jan 5, 2014 15358 Views

An Accurate and Precise ddPCR-Based Method for Determining the Concentration of Plasmid DNA
Franco Puleo [...] Cullen Mason
Jul 20, 2026 249 Views

Efficient and Fast Site-Directed Mutagenesis via Partially or Completely Overlapping Primer Pairs
Paulina Varela-Castillo [...] Xiang-Jiao Yang
Aug 20, 2026 267 Views
Abstract
This protocol describes the basic principle of PCR/restriction digest genotyping of point mutations in worms, based on the principle of Restriction Fragment Length Polymorphism (RFLP) analysis. This type of genotyping is, particularly, useful when phenotypic analysis of animals carrying point mutations is difficult (e.g., in a complex genetic background).
I will illustrate the general procedures, using an example of daf-2 gene, encoding the sole insulin/IGF-1 receptor of C. elegans. Gems et al.(1998) did a very elegant job and characterized a series of mutations of daf-2, including the following two temperature-sensitive hypomorphic alleles:
daf-2(e1370): Substitution C/T (wild type/mutant), amino acid change: Missense P to S
Flanking sequences:
5’-CTCTATGAAATGGTTACACTCGGTGCTCAGCATATATTGGTTTGAGTAATGAGGTGT
Intracellular kinase domain, Class I, strong phenotype.
daf-2(e1368): Substitution C/T (wild type/mutant), amino acid change: Missense S to L
Flanking sequences:
5’-TCCGGAATTTACGTATTGAGGCAAAGTACTGTTCAGAAATVTATATGCTATCACAGT
Extracellular ligand binding domain, Class II, weak phenotype.
Here I will show you how to design the primers for PCR-RFLP analysis.
daf-2(e1370): Designed by Seung-Jae Lee from the Kenyon lab
Forward primer: 5’-CGGGATGAGACTGTCAAGATTGGAGATTTCGG-3’
Reverse primer: 5’-CAACACCTCATCATTACTCAAACCAATCCATG-3’
On the (-) strand, the nucleotide next to the 3’ end of reverse primer is G in wild-type allele, which is mutated to T in daf-2(e1370). Thus, by introducing another mutation (double C here, highlighted) into the reverse primer, it creates an Nco I-restriction site (i.e., CCATGG) only for PCR products derived from wild-type but NOT daf-2(1370).
daf-2(e1368): Designed by Peichuan Zhang from the Kenyon lab
Forward primer: 5’-GTTCCGGAATTTACGACGTATTGAGGCAACG-3’
Reverse primer: 5’-CTATCGGATCGAGTGGTATATTTAAC-3’
Similarly, on the (+) strand, the nucleotides next to the 3’ end of forward primer are TC in wild-type allele, and TT in daf-2(e1368). Thus, by introducing another mutation (C here, highlighted) into the forward primer, a restriction site of Acl I (i.e., AACGTT) is generated in the presence of daf-2(1368) point mutation.
The key is to introduce new mutation(s) at the 3’ end of one of your primers. Since the difference of the sizes of digest products is just ~30-bp, the length of the primer, you have to pick the other primer to generate an amplicon of ~200-bp – 250-bp or so.
Here is a website that can help you design the primers with appropriate restriction site for genotyping: http://helix.wustl.edu/dcaps/dcaps.html (dCAPS Finder 2.0) (Neff et al., 2002).
Materials and Reagents
Equipment
Procedure
| DNAase-free ddH2O | 11.0 μl |
| dNTP mix (10 mM each) | 0.4 μl (final, 200 μM each) |
| Forward primer (10 μM) | 0.4 μl (final, 0.2 μM each) |
| Reverse primer (10 μM) | 0.4 μl (final, 0.2 μM each) |
| PCR buffer (10x) | 2.0 μl (final, 1x) |
| MgCl2 (50 mM) | 0.8 μl (final, 2.0 mM) |
| Worm lysates (20 μl) | 2.0 μl |
| Taq (5 U/μl) | 0.1 μl (final, 0.5 U per reaction) |
| 1 cycle | 94 °C, 3 min |
| 30 cycles | 94 °C, 10 sec; 58 °C, 30 sec; 72 °C, 30 sec |
| 1 cycle | 72 °C, 10 min |
| ddH2O | 2.5 μl |
| 10x buffer | 2.5 μl |
| Enzyme (5 U/μl to 20 U/μl) | 0.2 μl |
Representative data

Figure 1. Representative data of PCR genotyping are shown here. 20 μl of daf-2(e1370) allele-genotyping PCR products were digested with Nco I at 37 ºC overnight. The digested DNA fragments were resolved on a 2.0% agarose gel. Expected sizes of DNA bands: wild-type, 202-bp; daf-2(e1370) mutation, 234-bp. Lane 1: 1 Kb Plus DNA Ladder. Lane 2, 7, 8: daf-2(e1370)+/+; Lane 4, 5: daf-2(e1370)+/-; Lane 3, 6: daf-2(e1370)-/-. The results are highly reproducible, and necessary controls should always be included to assure the results.
Recipes
Acknowledgments
This protocol was adapted from work performed by members of the Kenyon lab, including PZ. PZ was supported by a postdoctoral fellowship from the Larry Hillblom Foundation.
References
Article Information
Copyright
© 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Zhang, P. (2012). PCR-RFLP Genotyping of Point Mutations in Caenorhabditis elegans. Bio-protocol 2(6): e128. DOI: 10.21769/BioProtoc.128.
Category
Molecular Biology > DNA > Genotyping
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link