Welcome guest, Sign in

Home

X
加载中

Drug-induced mitochondrial injury can be caused by many different mechanisms including inhibition of mitochondrial DNA replication, transcription, translation, and altered protein function. Determination of the level of mitochondrial DNA relative to the nuclear DNA levels provides important information on potential mitochondrial toxicity.

Thanks for your further question/comment. It has been sent to the author(s) of this protocol. You will receive a notification once your question/comment is addressed again by the author(s).
Meanwhile, it would be great if you could help us to spread the word about Bio-protocol.

X

Determination of Mitochondrial DNA Upon Drug Treatment

Molecular Biology > DNA > DNA damage and repair
Authors: Michel Perron
Michel PerronAffiliation: Department of Biology, Gilead Sciences, Foster City, USA
Bio-protocol author page: a1934
 and Joy Y. Feng
Joy Y. FengAffiliation: Department of Biology, Gilead Sciences, Foster City, USA
For correspondence: joy.feng@gilead.com
Bio-protocol author page: a1935
Vol 5, Iss 2, 1/20/2015, 1500 views, 0 Q&A, How to cite
DOI: http://dx.doi.org/10.21769/BioProtoc.1377

[Abstract] Drug-induced mitochondrial injury can be caused by many different mechanisms including inhibition of mitochondrial DNA replication, transcription, translation, and altered protein function. Determination of the level of mitochondrial DNA relative to the nuclear DNA levels provides important information on potential mitochondrial toxicity.

Keywords: Mitochondrial toxicity, Nucleoside analogs, Inhibitor of DNA synthesis

Materials and Reagents

  1. HepG2 cells (ATCC, catalog number: HB 8065)
  2. DMSO (cell culture grade) (Sigma-Aldrich, catalog number: D2650)
  3. Phosphor-buffered saline (PBS) (Life Sciences, catalog number: 10010049)
  4. QIAamp DNA mini kit (QIAGEN, catalog number: 51304)
  5. TaqMan universal mastermix (Life Technologies, Applied Biosystems®, catalog number: 4352042)
  6. β-actin Assay-on-Demand kit (Life Technologies, Applied Biosystems®, catalog number: 4331182)
  7. Eagle’s minimum essential medium (Life Technologies, Gibco®, catalog number: 41090)
  8. GlutaMAXTM
  9. Fetal bovine serum (FBS) (HyClone, catalog number: SH30071.03)
  10. 100 units/ml penicillin, 100 units/ml streptomycin (Life Technologies, Gibco®, catalog number: 15140)
  11. Sodium pyruvate (Life Technologies, Gibco®, catalog number: 11360)
  12. Cells were cultured in Eagle’s minimum essential medium (see Recipes)
    Note: Cells were cultured in Eagle’s minimum essential medium.

Equipment

  1. 12-well plates (Corning, catalog number: 3513)
  2. ABI Prism 7900HT Fast Real-Time PCR system (Life Technologies, Applied Biosystems®)

Procedure

  1. HepG2 cells were seeded into 12-well plates at a density of 2 x 105 cells per well and allowed to attach overnight. The volume of medium was 1.0 ml in each well.
  2. After the overnight incubation, the media in each well was replaced with 1.0 ml of fresh media containing tested compounds and controls, and incubated for 10 more days. The media was replaced with fresh media and compounds every 3 to 4 days. The DMSO concentration was kept at 1.0% for all treatments including control samples (no drug, DMSO only).
  3. Following the incubation, the cells were washed once with PBS and the total DNA was extracted from the cells using the QIAamp DNA Mini Kit according to the manufacturer’s protocol.
  4. Real-time PCR reactions were performed using TaqMan universal mastermix in an ABI Prism 7900HT Fast Real-Time PCR System.
  5. Quantification of mtDNA was achieved by amplification of a fragment of the mitochondrial specific cytochrome b gene using the primers and probe described in Table 1. Chromosomal DNA was quantified by the amplification of a fragment of the β-actin gene using a β-actin Assay-on-Demand kit.
  6. Amplification reactions for the quantification of mitochondrial and chromosomal DNA were performed independently using approximately 25 ng of total DNA in a volume of 20 μl.

    Table 1. Real-Time PCR primers and probe used in the quantification of the cytochrome b gene from HepG2 cells
    Primer/probe name
    Oligonucleotide sequence
    Concentration in qPCR
    Cytochrome b forward
    CCTTCCACCCTTACTACACAATCAA
    0.9 μM
    Cytochrome b reverse
    GGTCTGGTGAGAATAGTGTTAATGTCA
    0.9 μM
    Cytochrome b probe
    FAM-ACGCCCTCGGCTTAC-BHQ1
    0.2 μM

  7. Data analysis
    1. The relative amount of mtDNA in treated samples was determined using a relative quantification method based upon the 2-ΔΔCT formula (Livak and Schmittgen, 2001).
    2. The amount of mtDNA (% mtDNA) in compound treated samples relative to the DMSO treated controls was calculated based upon the following formula:
      % mtDNA = 100 x 2-ΔΔCT
      ΔΔCT = ΔCT, treated – ΔCT, control
      ΔCT, treated = (CT, cyt b – CT, β-actin) treated
      ΔCT, control = (CT, cyt b – CT, β-actin) control
      CT, cyt b and CT, β-actin represent the cycle threshold values for the amplification of cytochrome b and β-actin, respectively, as determined by the computational analysis of amplification curves using the ABI Prism software. The final results are presented as the mean % mtDNA ± SD from 3 independent experiments, each performed in triplicate.
    3. The 2-ΔΔCT method was validated for cytochrome b and β-actin genes by determining the ΔCT values for amplification reactions containing various amounts of total cellular DNA. Minimal differences were observed in the ΔCT values in samples containing 5 to 40 ng of total cellular DNA; indicating that neither the amplification nor detection efficiencies of cytochrome b and β-actin were affected by the amount of DNA template within the dilution range relevant for the quantitative analysis performed in this study Table 2.
    4. The effect of a positive control compound ddC (dideoxy cytidine) is shown in Table 3.

      Table 2. Validation of the 2-ΔΔCT method for cytochome b and β-actin target genes
      Amount of total cellular DNA (ng/reaction)
       CT Valuea
      ΔCT Value
      Cytochome b
      β-actin
      5
      15.7 ± 0.4
      22.2 ± 0.3
      -6.6 ± 0.1
      10
      17.3 ± 0.4
      23.9 ± 0.3
      -6.7 ± 0.1
      20
      18.8 ± 0.3
      25.7 ± 0.3
      -6.9 ± 0.1
      40
      20.3 ± 0.4
      27.3 ± 0.3
      -7.0 ± 0.1
      aThe data represent the mean ± SD of 3 independent experiments performed in triplicate

      Table 3. Effect of positive control ddC on the levels of mtDNA in HepG2 cells
      Compound
      Concentration
      (μM)
      Relative amount of
      mtDNA (% mtDNA)a
      p-value compared to DMSO (control)b
      DMSO (control)
      -
      100.0 ± 8.8
      -
      ddC
      0.2
      57.0 ± 10.4
      < 0.0001
      2.0
      25.1 ± 7.8
      < 0.0001
      20
      6.9 ± 2.9
      < 0.0001
      aThe data represent the mean ± SD of 3 independent experiments performed in triplicate
      bPaired, two-tailed Student’s t-test

Recipes

  1. Eagle’s minimum essential medium
    GlutaMAXTM
    10% fetal bovine serum
    100 units/ml penicillin
    100 units/ml streptomycin
    1 mM sodium pyruvate

Acknowledgments

All of the work was sponsored by Gilead Sciences, Inc. This protocol was adapted from Feng et al. (2014).

References

  1. Feng, J. Y., Cheng, G., Perry, J., Barauskas, O., Xu, Y., Fenaux, M., Eng, S., Tirunagari, N., Peng, B., Yu, M., Tian, Y., Lee, Y. J., Stepan, G., Lagpacan, L. L., Jin, D., Hung, M., Ku, K. S., Han, B., Kitrinos, K., Perron, M., Birkus, G., Wong, K. A., Zhong, W., Kim, C. U., Carey, A., Cho, A. and Ray, A. S. (2014). Inhibition of hepatitis C virus replication by GS-6620, a potent C-nucleoside monophosphate prodrug. Antimicrob Agents Chemother 58(4): 1930-1942.
  2. Livak, K. J. and Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4): 402-408.


How to cite this protocol: Perron, M. and Feng, J. Y. (2015). Determination of Mitochondrial DNA Upon Drug Treatment. Bio-protocol 5(2): e1377. DOI: 10.21769/BioProtoc.1377; Full Text



Share Your Feedback:

  • Add Photo
  • Add Video

Bio-protocol's major goal is to make reproducing an experiment an easier task. If you have used this protocol, it would be great if you could share your experience by leaving some comments, uploading images or even sharing some videos. Please login to post your feedback.

Q&A and Troubleshooting:

  • Add Photo
  • Add Video

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.


Login | Register
Share
Twitter Twitter
LinkedIn LinkedIn
Google+ Google+
Facebook Facebook