Welcome guest, Sign in

Home

X
加载中

This protocol describes the basic principle of PCR/restriction digest genotyping of point mutations in worms, based on the principle of Restriction Fragment Length Polymorphism (RFLP) analysis. This type of genotyping is, particularly, useful when phenotypic analysis of animals carrying point mutations is difficult (e.g., in a complex genetic background).
I will illustrate the general procedures, using an example of daf-2 gene, encoding the sole insulin/IGF-1 receptor of C. elegans. Gems et al.(1998) did a very elegant job and characterized a series of mutations of daf-2, including the following two temperature-sensitive hypomorphic alleles:
daf-2(e1370): Substitution C/T (wild type/mutant), amino acid change: Missense P to S
Flanking sequences:
5’-CTCTATGAAATGGTTACACTCGGTGCTCAGCATATATTGGTTTGAGTAATGAGGTGT
Intracellular kinase domain, Class I, strong phenotype.
daf-2(e1368): Substitution C/T (wild type/mutant), amino acid change: Missense S to L
Flanking sequences:
5’-TCCGGAATTTACGTATTGAGGCAAAGTACTGTTCAGAAATVTATATGCTATCACAGT
Extracellular ligand binding domain, Class II, weak phenotype.
Here I will show you how to design the primers for PCR-RFLP analysis.
daf-2(e1370): Designed by Seung-Jae Lee from the Kenyon lab
Forward primer: 5’-CGGGATGAGACTGTCAAGATTGGAGATTTCGG-3’
Reverse primer: 5’-CAACACCTCATCATTACTCAAACCAATCCATG-3’
On the (-) strand, the nucleotide next to the 3’ end of reverse primer is G in wild-type allele, which is mutated to T in daf-2(e1370). Thus, by introducing another mutation (double C here, highlighted) into the reverse primer, it creates an Nco I-restriction site (i.e., CCATGG) only for PCR products derived from wild-type but NOT daf-2(1370).
daf-2(e1368): Designed by Peichuan Zhang from the Kenyon lab
Forward primer: 5’-GTTCCGGAATTTACGACGTATTGAGGCAACG-3’
Reverse primer: 5’-CTATCGGATCGAGTGGTATATTTAAC-3’
Similarly, on the (+) strand, the nucleotides next to the 3’ end of forward primer are TC in wild-type allele, and TT in daf-2(e1368). Thus, by introducing another mutation (C here, highlighted) into the forward primer, a restriction site of Acl I (i.e., AACGTT) is generated in the presence of daf-2(1368) point mutation.
The key is to introduce new mutation(s) at the 3’ end of one of your primers. Since the difference of the sizes of digest products is just ~30-bp, the length of the primer, you have to pick the other primer to generate an amplicon of ~200-bp – 250-bp or so.
Here is a website that can help you design the primers with appropriate restriction site for genotyping: http://helix.wustl.edu/dcaps/dcaps.html (dCAPS Finder 2.0) (Neff et al., 2002).

Thanks for your further question/comment. It has been sent to the author(s) of this protocol. You will receive a notification once your question/comment is addressed again by the author(s).
Meanwhile, it would be great if you could help us to spread the word about Bio-protocol.

X

PCR-RFLP Genotyping of Point Mutations in Caenorhabditis elegans

Molecular Biology > DNA > Genotyping
Author: Peichuan Zhang
Peichuan ZhangAffiliation: Department of Biochemistry and Biophysics, University of California, San Francisco, USA
For correspondence: peichuan.zhang@ucsf.edu
Bio-protocol author page: a11
Vol 2, Iss 6, 3/20/2012, 11257 views, 3 Q&A, How to cite
DOI: https://doi.org/10.21769/BioProtoc.128

[Abstract] This protocol describes the basic principle of PCR/restriction digest genotyping of point mutations in worms, based on the principle of Restriction Fragment Length Polymorphism (RFLP) analysis. This type of genotyping is, particularly, useful when phenotypic analysis of animals carrying point mutations is difficult (e.g., in a complex genetic background).
I will illustrate the general procedures, using an example of daf-2 gene, encoding the sole insulin/IGF-1 receptor of C. elegans. Gems et al.(1998) did a very elegant job and characterized a series of mutations of daf-2, including the following two temperature-sensitive hypomorphic alleles:
daf-2(e1370): Substitution C/T (wild type/mutant), amino acid change: Missense P to S
Flanking sequences:
5’-CTCTATGAAATGGTTACACTCGGTGCTCAGCATATATTGGTTTGAGTAATGAGGTGT
Intracellular kinase domain, Class I, strong phenotype.
daf-2(e1368): Substitution C/T (wild type/mutant), amino acid change: Missense S to L
Flanking sequences:
5’-TCCGGAATTTACGTATTGAGGCAAAGTACTGTTCAGAAATVTATATGCTATCACAGT
Extracellular ligand binding domain, Class II, weak phenotype.
Here I will show you how to design the primers for PCR-RFLP analysis.
daf-2(e1370): Designed by Seung-Jae Lee from the Kenyon lab
Forward primer: 5’-CGGGATGAGACTGTCAAGATTGGAGATTTCGG-3’
Reverse primer: 5’-CAACACCTCATCATTACTCAAACCAATCCATG-3’
On the (-) strand, the nucleotide next to the 3’ end of reverse primer is G in wild-type allele, which is mutated to T in daf-2(e1370). Thus, by introducing another mutation (double C here, highlighted) into the reverse primer, it creates an Nco I-restriction site (i.e., CCATGG) only for PCR products derived from wild-type but NOT daf-2(1370).
daf-2(e1368): Designed by Peichuan Zhang from the Kenyon lab
Forward primer: 5’-GTTCCGGAATTTACGACGTATTGAGGCAACG-3’
Reverse primer: 5’-CTATCGGATCGAGTGGTATATTTAAC-3’
Similarly, on the (+) strand, the nucleotides next to the 3’ end of forward primer are TC in wild-type allele, and TT in daf-2(e1368). Thus, by introducing another mutation (C here, highlighted) into the forward primer, a restriction site of Acl I (i.e., AACGTT) is generated in the presence of daf-2(1368) point mutation.
The key is to introduce new mutation(s) at the 3’ end of one of your primers. Since the difference of the sizes of digest products is just ~30-bp, the length of the primer, you have to pick the other primer to generate an amplicon of ~200-bp – 250-bp or so.
Here is a website that can help you design the primers with appropriate restriction site for genotyping: http://helix.wustl.edu/dcaps/dcaps.html (dCAPS Finder 2.0) (Neff et al., 2002).

Keywords: C. elegans, PCR genotyping, Point mutation

Materials and Reagents

  1. PK lysis buffer
  2. Proteinase K (Sigma-Aldrich, catalog number: P6556)
  3. Common PCR reagent (e.g., Invitrogen PCR kit – Life Technologies, Invitrogen™, catalog number: 10342-020; or home-made Taq and buffer)
  4. Restriction enzymes (NEB)
  5. Agarose gel
  6. Ethidium bromide (Life Technologies, Invitrogen™, catalog number: 15585-011)
  7. Plus DNA Ladder (Life Technologies, Invitrogen™, catalog number: 10787-018)

Equipment

  1. MJ Research PTC-200 Thermo Cycler (MJ Research)
  2. Thin-wall PCR tubes (USA Scientific, catalog numbers: 1402-2700 or 1405-8100)

Procedure

  1. Isolate genomic DNA with proteinase K digest.
    Tip 1. Typically, a large amount of PK lysis buffer is prepared (for the recipe, please refer to Caenorhabditis elegans/DNA/Single worm PCR) with supplement of proteinase K, and then small aliquots are stored (e.g., 1 ml) at -20 °C. This robust enzyme works well at a range from 20 μg/ml to 100 μg/ml, and the key is to activate it at 60 °C for ~1 h and then kill it at 95 °C for ~15 min or so. You do not want to see proteinase K torture your Taq enzyme during the subsequent PCR reaction.
    Tip 2. I prefer to pick reasonable numbers (e.g, 10) of gravid adult animals and stick them into a PCR tube with PK lysis buffer (e.g, 20 μl). It does not hurt to use more than 1 worm per PCR reaction (genomic DNA from ~1/2 worm works just fine for most robust PCR genotyping). For PCR-RFLP, it’d be better to use more than 1 worm per reaction (e.g., 5 to 10). However, too much DNA template, in some cases, may inhibit your PCR reactions.
  2. Perform a standard PCR, 20 μl per reaction.
    1. Set up the PCR, by adding the following component into a thin-wall PCR tube on ice in this order:
      DNAase-free ddH2O
      11.0 μl
      dNTP mix (10 mM each)
      0.4 μl (final, 200 μM each)
      Forward primer (10 μM)
      0.4 μl (final, 0.2 μM each)
      Reverse primer (10 μM)
      0.4 μl (final, 0.2 μM each)
      PCR buffer (10x)
      2.0 μl (final, 1x)
      MgCl2 (50 mM)
      0.8 μl (final, 2.0 mM)
      Worm lysates (20 μl)
      2.0 μl
      Taq (5 U/μl)
      0.1 μl (final, 0.5 U per reaction)
    2. Run PCR (put the tube on the block when it is hot):
      1 cycle
      94 °C, 3 min
      30 cycles
      94 °C, 10 sec; 58 °C, 30 sec; 72 °C, 30 sec
      1 cycle   
      72 °C, 10 min

  3. Digest with respective enzymes, 37 °C, O/N. Prepare multiplex (N+2) for N reactions:
    ddH2O
    2.5 μl
    10x buffer
    2.5 μl
    Enzyme (5 U/μl to 20 U/μl)
    0.2 μl
    Aliquot 5.0 μl into each PCR tube.

  4. Resolve O/N digest of PCR products on 2.0%-2.5% agarose gel.
    For daf-2(1370):
    Bands expected from Nco I-digest (NEB buffer 3): Wild-type, 202-bp; mutation, 234-bp.
    For daf-2(1368):
    Bands expected from Acl I-digest (NEB buffer 4 + BSA): Wild-type, 215-bp; mutation, 186-bp.
    Tip 3. Due to the small difference between the sizes of products, it is recommended to run the gel for a long time. Always add wild-type and mutants with known genotypes as controls. Ethidium bromide migrates toward cathode (-), just the opposite to the direction of DNA migration. To help subsequent visualization of DNA under UV light, it would be advised to add a few microliter of ethidium bromide (10 mg/ml) into the electrophoresis buffer near the anode (+).

Representative data



Figure 1. Representative data of PCR genotyping are shown here.
20 μl of daf-2(e1370) allele-genotyping PCR products were digested with Nco I at 37 ºC overnight. The digested DNA fragments were resolved on a 2.0% agarose gel. Expected sizes of DNA bands: wild-type, 202-bp; daf-2(e1370) mutation, 234-bp. Lane 1: 1 Kb Plus DNA Ladder. Lane 2, 7, 8: daf-2(e1370)+/+; Lane 4, 5: daf-2(e1370)+/-; Lane 3, 6: daf-2(e1370)-/-. The results are highly reproducible, and necessary controls should always be included to assure the results.

Recipes

  1. PK lysis buffer
    10 mM Tris-HCl (pH 8.0)
    50 mM KCl
    2.5 mM MgCl2
    0.45% Tween-20
    0.05% gelatin
    20 g/ml proteinase K
    Prepare and store small aliquots at -20 °C

Acknowledgments

This protocol was adapted from work performed by members of the Kenyon lab, including PZ. PZ was supported by a postdoctoral fellowship from the Larry Hillblom Foundation.

References

  1. Gems, D., Sutton, A. J., Sundermeyer, M. L., Albert, P. S., King, K. V., Edgley, M. L., Larsen, P. L. and Riddle, D. L. (1998). Two pleiotropic classes of daf-2 mutation affect larval arrest, adult behavior, reproduction and longevity in Caenorhabditis elegans. Genetics 150(1): 129-155.
  2. Neff, M. M., Turk, E. and Kalishman, M. (2002). Web-based primer design for single nucleotide polymorphism analysis. Trends Genet 18(12): 613-615.


How to cite: Zhang, P. (2012). PCR-RFLP Genotyping of Point Mutations in Caenorhabditis elegans. Bio-protocol 2(6): e128. DOI: 10.21769/BioProtoc.128; Full Text



Share Your Feedback:

  • Add Photo
  • Add Video

Bio-protocol's major goal is to make reproducing an experiment an easier task. If you have used this protocol, it would be great if you could share your experience by leaving some comments, uploading images or even sharing some videos. Please login to post your feedback.

Q&A and Troubleshooting:

  • Add Photo
  • Add Video

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.


Login | Register
2/17/2012 2:09:32 AM  

Hi Peichuan,

Nice protocol!

I have a few questions about the electrophoresis condition you use: Do you use regular agarose for the gel? And do you use TAE or TBE buffer? I'm deciding whether to use agarose gel or acrylamide gel, and can you give me some suggestions?

Thank you very much!

Sophia

2/17/2012 7:20:27 AM  

Peichuan Zhang (Author)
Department of Biochemistry and Biophysics, University of California

Hi Sophia,

Thanks! I'm glad that our protocols have attracted attention from potential users.

We have been using regular agarose gel (2.0%) and 1X TAE buffer all the time. In my case, I need to separate two bands of about 200-bp (with difference of ~30-bp), and sometimes, I used 2.5% agarose gel instead. Try to not use too high voltage to avoid "smiling effects", and always remember to have positive and negative controls for comparison. Also use fresh 1X TAE buffer, as its buffering capacity drops significantly after a few rounds. You may consider designing a few different PCR-restriction digest strategies and pick the one that produces best resolution.

I only used TBE buffer, which is better than TAE in its buffering capacity, for gel shifting experiments. I recall that I saw some notes about achieving better resolution with TBE for smaller DNA (<300-bp on 2% agarose gel).

Hope this would help you a bit. Please let me know if you have further questions, and best luck with your experiments.

Peichuan

2/17/2012 11:42:05 PM  

Sophia
VT

Hi Peichuan,

Thank you so much for your detailed explanation! I'm going to try out your protocol and will let you know of my progress.

Sophia

Reply

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.

Login | Register

8/19/2011 4:10:18 AM  

Jimmy
Tufts University Medical School

Hi Peichuan,

I actually had some success using Taq w/out exo ability from NEB. I saw the restriction cut product band shift ~30 bp lower than the uncut product (as well as a 30BP band faintly below). So thank you for the suggestion! Since we have a DNA synthesis core here it was very easy and quick to get new primers.

Interestingly I continued 1 last effort to see if the phosphorothioate bond would at least HELP prevent exonuclease activity, so I performed touchdown PCR and added 3%DMSO and decreased dNTP (all to increase the specificity) and I actually got a product that was successfully cut by enzyme, but only half of the product. I assume this means the DNA I'm examining is heterozygous for the mutation (Diploid organism). My reasoning is that maybe with added specificity of TD PCR the Hi Fidelity enzyme is chewing back only on the non-complementary chromosomal DNA but leaving the complementary (except for the 1 pt mut) intact? And if so, does this mean non-proofreading taq cannot distinguish between homozygous and heterozygous?

Thank you very much, and sorry for accidentally posting 3 times last time! :)

8/19/2011 7:22:19 AM  

Peichuan Zhang (Author)
Department of Biochemistry and Biophysics, University of California

Hi Jimmy,

Very glad that it worked out well for you. And thanks so very much for sharing your own experience, which is great and would definitely help us improve the protocol as provided on our website. We hope to provide more high-quality author-validated protocols to share among our research community.

I believe that you have taken right action for PCR, by using modified primer, touchdown strategy and DMSO, to improve amplification specificity/efficacy in your case.

Most Taq enzymes, unless otherwise modified, do not possess 3'->5' proof-reading exonuclease activities. Please check the info that I have found from NEB
http://www.neb.com/nebecomm/products/faqproductm0273.asp

In my case of daf-2 genotyping, I could actually distinguish heterozygote from homozygote. I could tell about two bands for heterozygotes, with wild type and daf-2 homozygotes as controls. I also used just regular desalted primers for genotyping.

BTW, to confirm the PCR genotyping results, you can also use regular Taq to amplify a PCR product (e.g., 500-bp or so) around the mutation, and then sequence the product with a primer.

Best,
Peichuan

Reply

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.

Login | Register

8/17/2011 9:42:26 PM  

Jimmy
Tufts University Medical School

Hi,

I have actually being trying to do almost this exact same thing, only I have had no luck introducing a point mutant at the 3' ends of my primers in order to complete a restriction site (in the mutant version only). I believe its because I'm using a proofreading enzyme which sees the base mismatch and cleaves it off, so I ordered a primer with a phosphorothioate modification to prevent exonuclease activity by the DNA pol, but I am still having no luck. Should I switch to a non-proofreading enzyme (regular taq)? And when you perform your restriction digest do you see the 30BP band or do you just look for a decrease in your 200BP band?

Thank you very much!

Jimmy

8/18/2011 1:01:21 PM  

Peichuan Zhang (Author)
Department of Biochemistry and Biophysics, University of California

Hi Jimmy,

I used very typical recombinant Taq (e.g., Invitrogen 10342-020) and it worked pretty well in my hand (home-made Taq also worked). I would recommend you not to use Taq w/ high proof-reading capacity.

The other thing that I have in mind is that you probably would like to re-design your primers. Put GC clamp at 5' end, but not more than 4 GC at the 3'-end. Treat them as primers for qPCR.

I run the gel for rather a long time (put a little bit of EtBr in the buffer), with the aim to separate the two bands, which differ just in ~30-bp or so (I don't really bother to check the 30-bp band though). In my case, I can always check the phenotypic readout for daf-2 mutations, which is dauer formation. If you have concern about the genotyping, you should also sequence the PCR product and check certain phenotype that are associated with the mutation.

Best luck,
Peichuan

Reply

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.

Login | Register

How to cite
Share
Twitter Twitter
LinkedIn LinkedIn
Google+ Google+
Facebook Facebook