Welcome guest, Sign in

Home

X
加载中

This protocol is used for the detection of immunoglobulin heavy (H) chain rearrangements. This PCR-based assay enables detection of DH-JH recombination in cultured hematopoietic cells (Schlissel et al., 1991; Satoh et al., 2013) [e.g. ES-derived cells (Satoh et al., 2013)].

Thanks for your further question/comment. It has been sent to the author(s) of this protocol. You will receive a notification once your question/comment is addressed again by the author(s).
Meanwhile, it would be great if you could help us to spread the word about Bio-protocol.

X

DNA PCR Assays for Igh Rearrangement

Immunology > Antibody analysis > Antibody function
Authors: Yusuke Satoh
Yusuke SatohAffiliation: Department of Lifestyle Studies, Kobe Shoin Women’s University, Kobe, Japan
For correspondence: ysatoh@shoin.ac.jp
Bio-protocol author page: a1162
Takao Sudo
Takao SudoAffiliation: Department of Hematology and Oncology, Osaka University Graduate School of Medicine, Suita, Japan
Bio-protocol author page: a1163
 and Takafumi Yokota
Takafumi YokotaAffiliation: Department of Hematology and Oncology, Osaka University Graduate School of Medicine, Suita, Japan
Bio-protocol author page: a1161
Vol 4, Iss 4, 2/20/2014, 2315 views, 0 Q&A, How to cite
DOI: http://dx.doi.org/10.21769/BioProtoc.1046

[Abstract] This protocol is used for the detection of immunoglobulin heavy (H) chain rearrangements. This PCR-based assay enables detection of DH-JH recombination in cultured hematopoietic cells (Schlissel et al., 1991; Satoh et al., 2013) [e.g. ES-derived cells (Satoh et al., 2013)].

Materials and Reagents

  1. Mouse spleen cells or ES-derived hematopoietic cells
  2. DNA extraction Kit: PerfectPure DNA Cultured Cell Kit (5 PRIME, catalog number: 2302000)
  3. 10x PCR Buffer with KCl (Life Technologies, Applied Biosystems®, catalog number: 4338856)
  4. MgCl2 (Life Technologies, Applied Biosystems®, catalog number: 4338856)
  5. Taq DNA polymerase (Life Technologies, Applied Biosystems®, catalog number: 4338856)
  6. dNTPs (Life Technologies, Applied Biosystems®, catalog number: 4338856)
  7. Primers (FASMAC)
    The sequence of primers are as follows.
    a. DHL(5’): GGAATTCG(AorC)TTTTTGT(CorG)AAGGGATCTACTACTGTG
    b. Mu0(5’): CCGCATGCCAAGGCTAGCCTGAAAGATTACC
    c. J3(3’): GTCTAGATTCTCACAAGAGTCCGATAGACCCTGG
  8. Agarose (UltraPureTM Agarose) (Life Technologies, InvitrogenTM, catalog number: 16500-100)
  9. Ethidium bromide (Wako Pure Chemical Industries, catalog number: 315-90051)

Equipment

  1. PCR Thermal Cycler (Veriti Thermal Cycler) (Life Technologies, Applied Biosystems®)
  2. Centrifuges (TOMY SEIKO, model: MX-150)
  3. Electrophoresis apparatus (ADVANCE, Mupid-exU)

Procedure

  1. Genomic DNA was prepared for PCR by lysing mouse spleen cells (1-4 x 104) or ES-derived hematopoietic cells (3-5 x 105) in 75 µl elution solution. See the manufacturer's protocol (http://www.5prime.com/media/3415/perfectpure dna cultured cell manual_5prime_1064553_122010.pdf).
  2. 20 µl PCR reactions contained 5.5 µl template (82.5 ng or less), 10 mM Tris-HCl, 50 mM KCl, 2.0 mM MgCl2, 1 µM primers (25 mers), 200 µM dNTPs and 1 U Taq DNA polymerase.
  3. PCR program
    a. 94 °C – 2 min
    b. 94 °C – 1 min
    c. 60 °C – 1 min
    d. 72 °C – 1.75 min
    e. Repeat steps b-d, 35x
    f. 72 °C – 10 min
  4. Half of each PCR products were electrophoresed on 1% agarose gels, and their amounts were evaluated by staining with ethidium bromide.
  5. DH-JH recombination was detected as amplified fragments of 1,033 bp, 716 bp and 333 bp using a primer DHL(5’) and J3(3’). Germline alleles were detected as an amplified fragment of 1,259 bp using a primer Mu0(5’) and J3(3’).

Results


Figure 1.DNA PCR assays of germline (GL) or DH-JH rearranged Igh chain (DJ) genes were performed with mouse splenocytes. A PCR experiment using a primer DHL(5’) and J3(3’) can detect three types of DH-JH rearrangement (J1, J2, and J3) (Schlissel et al., 1991). All of three bands are present with successful DH-JH rearrangement. However, a J1 band is sometimes undetected in the ethidium bromide-based DNA-band visualization when the amount of template DNA is very small. The size marker was loaded in the left lane.

Acknowledgments

This protocol was adapted from a previously published paper by Schlissel et al. (1991). The representative data shown in the protocol was adapted from Satoh et al. (2013).

References

  1. Satoh, Y., Yokota, T., Sudo, T., Kondo, M., Lai, A., Kincade, P. W., Kouro, T., Iida, R., Kokame, K., Miyata, T., Habuchi, Y., Matsui, K., Tanaka, H., Matsumura, I., Oritani, K., Kohwi-Shigematsu, T. and Kanakura, Y. (2013). The Satb1 protein directs hematopoietic stem cell differentiation toward lymphoid lineages. Immunity 38(6): 1105-1115. 
  2. Schlissel, M. S., Corcoran, L. M. and Baltimore, D. (1991). Virus-transformed pre-B cells show ordered activation but not inactivation of immunoglobulin gene rearrangement and transcription. J Exp Med 173(3): 711-720. 


How to cite this protocol: Satoh, Y., Sudo, T. and Yokota, T. (2014). DNA PCR Assays for Igh Rearrangement. Bio-protocol 4(4): e1046. DOI: 10.21769/BioProtoc.1046; Full Text



Share Your Feedback:

  • Add Photo
  • Add Video

Bio-protocol's major goal is to make reproducing an experiment an easier task. If you have used this protocol, it would be great if you could share your experience by leaving some comments, uploading images or even sharing some videos. Please login to post your feedback.

Q&A and Troubleshooting:

  • Add Photo
  • Add Video

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.


Login | Register
Share
Twitter Twitter
LinkedIn LinkedIn
Google+ Google+
Facebook Facebook