Materials and Reagents

1. Deoxynucleoside triphosphate (Roche Diagnostics, catalog number: 11969064001 )
   
2. Gamma [γ-³²P] ATP (PerkinElmer, catalog number: Blu502A001MC )
   
3. G-25 Macro spin columns (best suited for volumes of 75-150 μl) (Harvard Apparatus, catalog number: 74-3901 )
   
4. 40% Acrylamide-Bisacrylamide (19:1) solution (VWR International, catalog number: JT4969-0 )
   
5. T4 polynucleotide kinase (PNK) (New England Biolabs, catalog number: M0201L )
   
6. 10X T4 polynucleotide kinase buffer (New England Biolabs, catalog number: B0201S )
   
7. Urea (VWR International, catalog number: 97061-926 )
   
8. Ammonium Persulfate (VWR International, catalog number: 97064-594 )
   
9. HIV Reverse Transcriptase, purified as described in Hou et al. (2004) 
10. DNA oligonucleotides from Integrated DNA Technologies
    1. Template:
       5'-GGGCGAATTTAG[G/C]TTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTG G-3’. The underlined nucleotides in brackets indicate that templates with either a G or C at this position can be used depending on the type of mismatch examined.
       
    2. Primer:
       5ʹ-TAACCCTCACTAAAGGGAACAAAAX-3ʹ. “X” at the 3ʹ end of the primer denotes A, T, or C depending on the mismatch examined. “X” in the case of a matched primer is G.
11. 1 M MgCl₂
12. Extension reaction buffer (see Recipes)
13. 2x loading dye (see Recipes)
    

Equipment

1. Eppendorf tubes
   
2. Micropipette
   
3. Table top centrifuge
   
4. Incubator
   
5. Gel apparatus
   

Software

1. Sigmaplot Version 10.0 (Sysstat Software)

Procedure