Welcome guest, Sign in

Home

X
加载中

Detection of low copies of methylated DNA targets in clinical specimens is challenging. The quantitative Methylation-Specific PCR (qMSP) assays were designed to specifically amplify bisulphite-converted methylated DNA target sequences in the presence of an excess of unmethylated counterpart sequences. These qMSP assays are real-time PCR assays utilizing, sequence-specific primers and an intervening, also sequence specific, Taqman probe to cover an amplicon of approximately 100 bp in length. The use of Taqman probes bearing a minor groove binding (MGB) allow for the use of shorter probes and therefore facilitate design and significantly increases the analytical specificity of the reaction. In the context of the biomarker discovery program of the Liverpool Lung Project (LLP), ten gene promoters were selected. qMSP assays were developed, validated and used to screen 655 bronchial washings from patients with lung cancer and age/sex matched controls with non malignant lung disease (Nikolaidis et al., 2012).

Thanks for your further question/comment. It has been sent to the author(s) of this protocol. You will receive a notification once your question/comment is addressed again by the author(s).
Meanwhile, it would be great if you could help us to spread the word about Bio-protocol.

X

Quantitative Methylation Specific PCR (qMSP)

Cancer Biology > General technique > Biochemical assays > DNA structure and alterations
Authors: Triantafillos Liloglou
Triantafillos LiloglouAffiliation: Molecular & Clinical Cancer Medicine, University of Liverpool, Liverpool, UK
For correspondence: tliloglo@liv.ac.uk
Bio-protocol author page: a778
 and Georgios Nikolaidis
Georgios NikolaidisAffiliation: Molecular & Clinical Cancer Medicine, University of Liverpool, Liverpool, UK
Bio-protocol author page: a779
Vol 3, Iss 16, 8/20/2013, 7206 views, 0 Q&A, How to cite
DOI: http://dx.doi.org/10.21769/BioProtoc.871

[Abstract] Detection of low copies of methylated DNA targets in clinical specimens is challenging. The quantitative Methylation-Specific PCR (qMSP) assays were designed to specifically amplify bisulphite-converted methylated DNA target sequences in the presence of an excess of unmethylated counterpart sequences. These qMSP assays are real-time PCR assays utilizing, sequence-specific primers and an intervening, also sequence specific, Taqman probe to cover an amplicon of approximately 100 bp in length. The use of Taqman probes bearing a minor groove binding (MGB) allow for the use of shorter probes and therefore facilitate design and significantly increases the analytical specificity of the reaction. In the context of the biomarker discovery program of the Liverpool Lung Project (LLP), ten gene promoters were selected. qMSP assays were developed, validated and used to screen 655 bronchial washings from patients with lung cancer and age/sex matched controls with non malignant lung disease (Nikolaidis et al., 2012).

Materials and Reagents

  1. TaqMan® Universal Master Mix II no UNG (Life Technologies, catalog number: 4440039)
  2. TaqMan MGB probes (custom synthesis) (Life Technologies)
  3. EZ DNA Methylation-GoldTM kit (ZymoResearch, catalog number: D5006)
  4. The methylation-specific primer and probe sequences (see Recipes)

Equipment

  1. PCR cabinet
  2. PCR plates
  3. Centrifuge (Sigma-Aldrich)
  4. PCR thermal cycler (Life Technologies/Applied Biosystems, model: 9700)
  5. Real time PCR machine (Life Technologies/Applied Biosystems, model: 7500 FAST)

Procedure

  1. Primer/probe design
    Note: Primer/probe design is of major importance for the specificity of the reaction, i.e. to amplify only methylated bisulphite-converted target in the presence of excess unmethylated target. The primers should include 3-5 CG dinucleotides. The inclusion of at least two such CGs within the six 3’ end of the primer significantly increases specificity. This is in addition to the usual rules on primer stability, GC content and secondary structure avoidance apply in real time PCR assay design.
  2. One μg DNA was converted by sodium bisulphite using the EZ DNA Methylation-GoldTM kit and following the supplier’s protocol but eluting in 50 μl elution buffer (instead of the recommended 10 μl).
  3. The qMSP reactions contained 1x TaqMan® Universal Master Mix II non-UNG, 250 nM probe, 300-900 nM primers (Table 1) and 2 μl eluate from the bisulphite treated DNA sample.
    Note: The primer concentration is an important determinant of analytical sensitivity/specificity and has to be ascertained experimentally In other words the analytical sensitivity threshold is set to the dilution that has an overlapping 95% Confidence Interval with the unmethylated control reaction. In practical terms, the highest sensitivity one can use is the one that is always at least 2 ΔCt. lower than the unmethylated control.

    Table 1. Primer-probe concentrations for oligo mixes
    Primer/probe mix
    Final concentration (nM)
    Fwd primer
    Rev Primer
      Probe
    p16
    700
    700
    250
    TERT
    250
    250
    250
    RASSF1
    700
    700
    250
    TMEFF2
    900
    900
    250
    CYGB
    300
    300
    250
    RARb
    500
    500
    250
    DAPK1
    250
    250
    250
    p73
    250
    250
    250
    WT1
    750
    750
    250
    CDH13
    250
    250
    250
    ACTB
    900
    900
    250

  4. PCR plates were sealed and span at 4,000 x g for 1 min prior to be placed in the thermal cycler in order to bring all the reaction volume to the bottom and ensure removal of bubbles from the reaction mix.
  5. The reactions were performed in duplicate on a 7500 FAST real time cycler under the following thermal profile: 95 °C for 10 min activation step followed by 50 cycles consisted of denaturation at 95 °C for 15 sec, annealing and extension at 58 °C–65 °C (Table 2, depending on the assay) for 1 min.

    Table 2. Annealing information for qMSP optimised conditions
    Genes
    Annealing temp (°C)
    Time (sec)
    p16
    60
    60
    RASSF1
    60
    60
    CYGB
    64
    5
    61
    55
    RARB
    65
    5
    62
    55
    TERT
    65
    5
    62.5
    55
    WT
    62
    60
    ACTB
    58
    20
    60
    40
    CDH13
    64
    5
    61
    55
    DAPK
    65
    5
    62.5
    55
    P73
    65
    5
    62.5
    55
    TMEFF
    58
    20
    60
    40

Recipes

  1. The methylation-specific primer and probe sequences are listed in Table 3. In the initial steps of assay development it became apparent that probes bearing minor groove binding moiety (Taqman MGB probes) provided significantly higher assay specificity. In addition, due to their smaller size, they allow for a more flexible assay design.

    Table 3. Nucleotide sequences of methylation specific primers and probes for the qMSP assays utilised in the BW screening. The ACTB assay is methylation-independent acting as DNA input control.
    Primer/probe name
    Sequence 5’ →3’
    Modification
    p16meth_F
    GGAGGGGGTTTTTTCGTTAGTATC

    p16meth_R
    CTACCTACTCTCCCCCTCTCCG

    p16meth_P
    AACGCACGCGATCC
    FAM-MGB
    RASSF1meth_F
    GTGGTGTTTTGCGGTCGTC

    RASSF1meth_R
    AACTAAACGCGCTCTCGCA

    RASSF1_P
    CGTTGTGGTCGTTCG
    FAM-MGB
    TMEFF2meth_F
    GGAGAGTTAAGGCGTTTCGTAGTTC

    TMEFF2meth_R
    CGTGGGAAGAGGTAGTCGGG

    TMEFF2meth_P
    GTTTTTAGTTCGTTCG
    FAM-MGB
    TERTmeth_F
    TTGGGAGTTCGGTTTGGTTTC

    TERTmeth_R
    CACCCTAAAAACGCGAACGA

    TERTmeth_P
    AGCGTAGTTGTTTCGG
    FAM-MGB
    CYGBmeth_F
    GTGTAATTTCGTCGTGGTTTGC

    CYGBmeth_R
    CCGACAAAATAAAAACTACGCG

    CYGBmeth_P
    TGGGCGGGCGGTAG
    FAM-MGB
    RARbmeth_F
    GATTGGGATGTCGAGAACGC

    RARbmeth_R
    ACTTACAAAAAACCTTCCGAATACG

    RARbmeth_P
    AGCGATTCGAGTAGGGT
    FAM-MGB
    DAPK1meth_F
    CGAGCGTCGCGTAGAATTC

    DAPK1meth_R
    ACCCTACAAACGAACTAACGACG

    DAPK1meth_P
    AGCGTCGGTTTGGTAG
    FAM-MGB
    p73meth_F
    TTGTTTTTTGGATTTTAAGCGTTTC

    p73meth_R
    CACCCGAATCTCTCCTAACCG

    p73meth_P
    TAACGCTAAACTCCTCG
    FAM-MGB
    WT1meth_F
    GAGGAGTTAGGAGGTTCGGTC

    WT1meth_R
    CACCCCAACTACGAAAACG

    WT1meth_P
    AGTTCGGTTAGGTAGC
    FAM-MGB
    CDH13meth_F
    CGTGTATGAATGAAAACGTCGTC

    CDH13meth_R
    CACAAAACGAACGAAATTCTCG

    CDH13meth_P
    CGTTTTTAGTCGGATAAAA
    FAM-MGB
    ACTBmgb_F
    GGGTGGTGATGGAGGAGGTT

    ACTBmgb_R
    TAACCACCACCCAACACACAAT

    ACTBmgb_P
    TGGATTGTGAATTTGTGTTTG
    VIC-MGB

    Cycle threshold (Ct) values for each target were normalized for DNA input by calculating the ΔCt=Ct(Target)-Ct(ACTB). The values for al samples were transformed to relative quantity (RQ) compare to the calibrator (0.5% standard methylated DNA dilution) included in all experiments using the following type:
    RQsample = 2-ΔΔCt, whereΔΔCt = ΔCtsample - ΔCtcalibrator.
    Note: qMSP is a challenging version of real-time PCR and one needs to gain a very good understanding of the latter prior to engaging in qMSP experiments. The main additional challenge is the use of bisulphite DNA which is of lower quality but most importantly of lower complexity. This significantly affects the thermodynamic behavior of this template in the reaction. The authors are very happy to provide assistance to colleagues if needed; please email Dr. T Liloglou (tliloglo@liv.ac.uk).

Acknowledgments

This protocol is adapted from Nikolaidis et al. (2012).

References

  1. Liloglou, T., Bediaga, N. G., Brown, B. R., Field, J. K. and Davies, M. P. (2012). Epigenetic biomarkers in lung cancer. Cancer Lett 342(2): 200-212.
  2. Nikolaidis, G., Raji, O. Y., Markopoulou, S., Gosney, J. R., Bryan, J., Warburton, C., Walshaw, M., Sheard, J., Field, J. K. and Liloglou, T. (2012). DNA methylation biomarkers offer improved diagnostic efficiency in lung cancer. Cancer Res 72(22): 5692-5701.


How to cite this protocol: Liloglou, T. and Nikolaidis, G. (2013). Quantitative Methylation Specific PCR (qMSP). Bio-protocol 3(16): e871. DOI: 10.21769/BioProtoc.871; Full Text



Share Your Feedback:

  • Add Photo
  • Add Video

Bio-protocol's major goal is to make reproducing an experiment an easier task. If you have used this protocol, it would be great if you could share your experience by leaving some comments, uploading images or even sharing some videos. Please login to post your feedback.

Q&A and Troubleshooting:

  • Add Photo
  • Add Video

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.


Login | Register
Share
Twitter Twitter
LinkedIn LinkedIn
Google+ Google+
Facebook Facebook