Welcome guest, Login | Register

Home

X
加载中

This method is to roughly estimate DNA molecular weight. One of its applications is to calculate the ratio of vector to insert in a ligation reaction (please see Standard DNA Cloning protocol).
Anhydrous molecular weight of each nucleotide is (see reference 1):
A= 313.21
T= 304.2
C= 289.18
G=329.21
For rough estimation, typically average the molecular weights of all four, average weight of a DNA nucleotide (in salt solution) = 325 Daltons (see reference 2)
MW of a single-strand DNA molecule= (#of bp) x (325 Daltons/per base)
Moles of a ssDNA molecule = (grams of DNA)/ (MW in Daltons)
For accurate estimation of MW of ssDNA, an online calculator1 is available.

Thanks for your further question/comment. It has been sent to the author(s) of this protocol. You will receive a notification once your question/comment is addressed again by the author(s).
Meanwhile, it would be great if you could help us to spread the word about Bio-protocol.

X

[Bio101] DNA Molecular Weight Calculation

Molecular Biology > DNA > DNA quantification

[Abstract] This method is to roughly estimate DNA molecular weight. One of its applications is to calculate the ratio of vector to insert in a ligation reaction (please see Standard DNA Cloning protocol).
Anhydrous molecular weight of each nucleotide is (see reference 1):
A= 313.21
T= 304.2
C= 289.18
G=329.21
For rough estimation, typically average the molecular weights of all four, average weight of a DNA nucleotide (in salt solution) = 325 Daltons (see reference 2)
MW of a single-strand DNA molecule= (#of bp) x (325 Daltons/per base)
Moles of a ssDNA molecule = (grams of DNA)/ (MW in Daltons)
For accurate estimation of MW of ssDNA, an online calculator1 is available.


References

  1. http://www.basic.northwestern.edu/biotools/oligocalc.html.
  2. New England Biolabs catalog book.


How to cite this protocol: He, F. (2011). DNA Molecular Weight Calculation. Bio-protocol Bio101: e46. DOI: 10.21769/BioProtoc.46; Full Text



Reproducibility Feedback:

  • Add Photo
  • Add Video

Bio-protocol's major goal is to make reproducing an experiment an easier task. If you have used this protocol, it would be great if you could share your experience by leaving some comments, uploading images or even sharing some videos. Please login to post your feedback.

Q&A and Troubleshooting:

  • Add Photo
  • Add Video

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.


Login | Register
7/7/2016 7:48:50 PM  

viji ravi
alagappa university,karaikudi.

I have 6 micrograms of plasmid dna(puc 18) from 2 ml of axcenic culture.now my question is how many plasmids ( puc 18) expect from 6 micrograms of dna

Reply

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.

Login | Register

12/2/2014 9:31:17 AM  

yoandry Hinojosa
Censa

i would like to ask you something that I can undersatnd. I had read in some guide book of molecular biology and had found that average weiht of nuckleotide is 330 Dantons and I have read now in your page that is 325 Daltons, although I had knwe that before now the doub returned, I am not sure which can I use if the first or the second or both

12/7/2014 6:51:39 PM  

Fanglian He (Author)
Carnegie Institution for Science at Stanford

I have also seen 330 Daltons in other company's catalogs. "325" was cited from New England Biolabs catalog book. If you want to have a rough estimation of the MW of a DNA nucleotide, 330 or 325 might not matter that much.

But, If you know the number of As Cs Gs and Ts (or the number of GC and AT pairs), you can do a more accurate determination of MW of DNA (or dsDNA) based on the molecular weight of each monophosporylated nucleotides. I should also mention that the numbers provided in the current protocol are the molecular weight of each nucleotides given that they loose a water molecule of 18.0 when polymerized.

Hope this helps.

--Fanglian


Reply

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.

Login | Register

3/2/2014 6:15:16 AM  

Kh Hussein
Plymouth

What is the different between molecular weight and molecular mass of DNA please?

3/10/2014 5:30:05 PM  

Fanglian He (Author)
Carnegie Institution for Science at Stanford

I think, at least in practice, they are considered to be the same. For more explanation, you may find this link helpful, http://en.wikipedia.org/wiki/Molecular_mass.

--Fanglian

3/11/2014 1:08:24 AM  

Kh Hussein
Plymouth

Many thanks for reply, regards

Reply

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.

Login | Register

10/31/2012 6:49:57 PM  

GCAGGCCTGAGCCCTGCACCCGCCCCACGACCGTCCAGCCCCTGACGGGGCACCCCATCC

Reply

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.

Login | Register

5/17/2012 3:37:58 AM  

CACCTTCATC

5/17/2012 3:48:56 AM  

Fanglian He (Author)
Carnegie Institution for Science at Stanford

I am not sure what your question was.

Reply

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.

Login | Register

5/13/2012 10:54:16 AM  

TAACAACCACTCAAACATAAGCTTTATGAAGTATGTAATTGCATTCAAAAAGCAATAGATAAGAATAATTATCATTTACT
AAGCTTATGAATATCTTGGATATTTAATGTAGCGCAAGCTAACATTTCGAGTGGACAAAATTCAAACAAGCTTCTAGTCT
TTATTGG

5/15/2012 6:01:37 AM  

Fanglian He (Author)
Carnegie Institution for Science at Stanford

please specify your question.

Reply

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.

Login | Register

3/17/2012 12:33:58 AM  

Thanks alot - your asnewr solved all my problems after several days struggling

Reply

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.

Login | Register