Welcome guest, Sign in

Home

X
加载中

Hepatitis B virus (HBV) can cause both acute and chronic disease in human liver with potentially high risk of cirrhosis and liver cancer. The host range of non-human primates susceptible to this virus is limited. Therefore, experimental studies with human hepatocyte-chimeric mice provide an invaluable source of information regarding the biology and pathogenesis of HBV. This section describes the protocol for infection of the human hepatocyte-chimeric mice with HBV. In addition, it has recently been shown that HBV replication can be suppressed by exogenous expression of viral epsilon RNA (εRNA; Sato et al., 2015), which serves as an encapsidation signal (Bartenschlager et al., 1992). Based upon this finding, we also describe the protocol for the liposome-mediated delivery of a plasmid encoding εRNA to liver in these chimeric mice.

Thanks for your further question/comment. It has been sent to the author(s) of this protocol. You will receive a notification once your question/comment is addressed again by the author(s).
Meanwhile, it would be great if you could help us to spread the word about Bio-protocol.

X

Infection of Human Hepatocyte-Chimeric Mice with HBV and in vivo Treatment with εRNA

Microbiology > Microbe-host interactions > In vivo model > Mammal
Authors: Seiichi Sato
Seiichi SatoAffiliation: Division of Signaling in Cancer and Immunology, Institute for Genetic Medicine, Molecular Medical Biochemistry Unit, Biological Chemistry and Engineering Course, Graduate School of Chemical Sciences and Engineering, Hokkaido University, Sapporo, Japan
Bio-protocol author page: a2878
Kai Li
Kai LiAffiliation: Division of Signaling in Cancer and Immunology, Institute for Genetic Medicine, Molecular Medical Biochemistry Unit, Biological Chemistry and Engineering Course, Graduate School of Chemical Sciences and Engineering, Hokkaido University, Sapporo, Japan
Bio-protocol author page: a2877
 and Akinori Takaoka
Akinori TakaokaAffiliation: Division of Signaling in Cancer and Immunology, Institute for Genetic Medicine, Molecular Medical Biochemistry Unit, Biological Chemistry and Engineering Course, Graduate School of Chemical Sciences and Engineering, Hokkaido University, Sapporo, Japan
For correspondence: takaoka@igm.hokudai.ac.jp
Bio-protocol author page: a2879
Vol 6, Iss 2, 1/20/2016, 678 views, 0 Q&A, How to cite
DOI: https://doi.org/10.21769/BioProtoc.1718

[Abstract] Hepatitis B virus (HBV) can cause both acute and chronic disease in human liver with potentially high risk of cirrhosis and liver cancer. The host range of non-human primates susceptible to this virus is limited. Therefore, experimental studies with human hepatocyte-chimeric mice provide an invaluable source of information regarding the biology and pathogenesis of HBV. This section describes the protocol for infection of the human hepatocyte-chimeric mice with HBV. In addition, it has recently been shown that HBV replication can be suppressed by exogenous expression of viral epsilon RNA (εRNA; Sato et al., 2015), which serves as an encapsidation signal (Bartenschlager et al., 1992). Based upon this finding, we also describe the protocol for the liposome-mediated delivery of a plasmid encoding εRNA to liver in these chimeric mice.

Keywords: Hepatitis B virus, Human hepatocyte-chimeric mice, Infection, Epsilon RNA

Materials and Reagents

  1. 0.1-10 μl pipet tips (Thermo Fisher Scientific, catalog number: QSP#TF104)
  2. 1-200 μl and 100-1,000 μl pipet tips (Corning, catalog number: 4845 and 4846, respectively)
  3. 0.2 ml 8 strips PCR tubes and caps (NIPPON Genetics, catalog number: FG-028DC)
  4. 1.5 ml and 2.0 ml microcentrifuge tubes (Corning, catalog number: MCT-150-A and MCT-200-C, respectively)
  5. 15 ml and 50 ml centrifuge tubes (Corning, catalog number: 352096 and 352070, respectively)
  6. 96-well fast plate (NIPPON Genetics, catalog number: 38801)
  7. 1 ml syringe (MonotaRO Co., NIPRO Genetics, catalog number: 08-010)
  8. Human hepatocyte-chimeric mice (PhoenixBio Co.)
    Note: Chimeric mice are intravenously infected with 100 μl of HBV-C in saline solution (106 copies per mouse) derived originally from patient with chronic hepatitis (Sugiyama et al., 2006).
  9. HBV (genotype C; HBV-C) (Dr. Yasuhito Tanaka, Department of Virology and Liver Unit, Nagoya City University Graduate School of Medical Sciences, Nagoya, Japan; Sugiyama et al., 2006)
  10. Sodium chloride (Nacalai tesque, catalog number: 31320-05)
  11. YSK lipid (a pH-sensitive cationic lipid) (Faculty of Pharmaceutical Sciences, Hokkaido University, Sapporo, Hokkaido, Japan) (Sato et al., 2012)
  12. Cholesterol (Avanti Polar Lipid, catalog number: 57-88-5)
  13. 1, 2-dimyristoyl-sn-glycerol methoxypolyethyleneglycol (PEG-DMG) (NOF Corporation, catalog number: GM-020)
  14. Nuclease free-H2O
  15. Citrate buffer (12.5 mM citrate, 500 mM NaCl)
  16. pCpGfree-mcs vector (Invivogen)
  17. Primers for vector construction
    pLKO.1 Fw SpeI: CCCACTAGTTTTCCCATGATTCCTTCATATTT
    pLKO.1 Rv BglII: CCCAGATCTAAAATTGTGGATGAATACTGCC
  18. TaqMan Universal PCR Master Mix (Life Technologies, catalog number: 4304437)
    Note: Currently, it is “Thermo Fisher Scientific, Applied Biosystems™, catalog number: 4304437”.
  19. Primers and probe for quantification of HBV DNA from HBV-infected chimeric mice sera:
    Forward Primer: SF2: 5’-CTTCATCCTGCTGCTATGCCT-3’
    Reverse Primer: SR2: 5’-AAAGCCCAGGATGATGGGAT-3’
    Probe: SP2: FAM-ATGTTGCCCGTTTGTCCTCTAATTCCAG-TAMRA
  20. MISSION® pLKO.1-puro Empty Vector Control Plasmid DNA (Sigma-Aldrich, catalog number: SHC001)
  21. DNA oligo nucleotides (5’-3’)
    Sense: CCGGTGTACATGTCCCACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGCATGGACATTTTTG
    Antisense:
    AATTCAAAAATGTCCATGCCCCAAAGCCACCCAAGGCACAGCTTGGAGGCTTGAACAGTGGGACATGTACA
  22. Oligo nucleotides (see Recipes)

Equipment

  1. Biosafety hood in a biosafety level 3 (BSL3) facility (HITACHI, catalog number: SCV-1303 ECIIB)
  2. Pipettes (PIPETMAN P2, P20 and P1000) (Gilson Scientific, catalog number: F144801, F123600 and F123602, respectively)
  3. qPCR adhesive seal (NIPPON Genetics, catalog number: 4Ti-0560)
  4. Applied Biosystems Veriti Thermal Cycler (Life Technologies, catalog number: 4375786)
    Note: Currently, it is “Thermo Fisher Scientific, Applied Biosystems™, catalog number: 4375786”.
  5. ABI StepOnePlusTM Real-Time PCR Systems (Life Technologies, catalog number: 4379216)
    Note: Currently, it is “Thermo Fisher Scientific, Applied Biosystems™, catalog number: 4379216”.

Procedure

  1. εRNA-MEND preparation
    1. The oligo nucleotides are annealed and inserted into an AgeI-EcoRI doubly digested pLKO.1-puro vector. With the ligated vector, the U6 promoter and εRNA-coding fragment are amplified through PCR by using a pair of primers (pLKO.1 Fw SpeI: CCCACTAGTTTTCCCATGATTCCTTCATATTT; pLKO.1 Rv BglII: CCCAGATCTAAAATTGTGGATGAATACTGCC), the PCR product is digested with SpeI and BglII and inserted into pCpGfree-mcs vector. This final construct is hereinafter called p-εRNA.


      Figure 1. A plasmid map of U6 promoter-driven εRNA expression vector (p-εRNA)

    2. The preparation of the p-εRNA loaded in a liposome carrier is based on the procedure that was previously described (Sato et al., 2012): p-εRNA or empty pCpGfree-mcs vector is formulated into lipid nanoparticles (MEND). 80 μg of p-εRNA or empty vector (in H2O) is dissolved with 120 μl of citrate buffer (12.5 mM citrate, 500 mM NaCl). Addition of this solution to 480 μl of the tertiary butanol containing YSK lipid (2,100 nmol), cholesterol (900 nmol), and 1, 2-dimyristoyl-sn-glycerol, methoxypolyethyleneglycol (150 nmol) leads to spontaneous formulation of liposomal particles (εRNA-MEND or control-MEND). The prepared εRNA-MEND is stocked at 4 °C until use.

  2. Infection of human hepatocyte-chimeric mice with HBV
    Note: All procedures involving the manipulation of HBV infectious materials should be conducted within biological safety cabinets (BSL3).
    Chimeric mice are intravenously infected with 100 μl of HBV-C in saline solution (106 copies per mouse) derived originally from patient with chronic hepatitis (Sugiyama et al., 2006). Three weeks after HBV infection, the sera are prepared by collecting blood samples from the tail vain and the efficiency of infection is confirmed by measuring the number of viral genome copies in the sera of HBV-infected chimeric mice by qPCR analysis as below:
    1. Prepare HBV DNA standard sample:
      The HBV plasmid (pUC19-HBV, genotype A) is subjected to a 10-fold serial dilutions in Nuclease free-H2O ranging from 1 x 103 to 1 x 109 copies/ml, and use 10 μl of this diluted sample (ranging from 1 x 10 to 1 x 107 copies/assay) as standard to quantification of HBV DNA.
    2. Set up qPCR reaction mixtures as follows (for one sample):
      DNA samples from sera of HBV-infected chimeric mice:

      Nuclease free-H2O
      6 μl
      TaqMan Universal PCR Master Mix
      12.5 μl
      Probe SP2 (10 μM)
      0.5 μl
      Forward primer SF2 (10 μM)
      0.5 μl
      Reverse primer SR2 (10 μM)
      0.5 μl
      HBV DNA sample (from sera)
      5 μl

      25 μl

      Standard DNA samples:
      Nuclease free-H2O
      1 μl
      TaqMan Universal PCR Master Mix
      12.5 μl
      Probe SP2 (10 μM)
      0.5 μl
      Forward primer SF2 (10 μM)
      0.5 μl
      Reverse primer SR2 (10 μM)
      0.5 μl
      Standard DNA:
      10 μl
      Total
      25 μl

      Note: Use 10 μl of nuclease free-H2O instead of standard DNA as negative control. Each sample is prepared in triplicate.
    3. Start the real-time PCR following the program as below:

      Holding stage
      95 °C
      10 min

      1 cycle
      Cycling stage
      95 °C
      15 sec

      45 cycles
      60 °C
      1 min
      Data collection
      Final holding stage
      4 °C




  3. In vivo treatment with εRNA
    At 4-week postinfection, εRNA-MEND or control-MEND, is administered intravenously at a dose of 0.5 mg/kg of body weight (n=3 per group) every two days for 14 days. Serum and liver samples can be subjected to qPCR for the quantification of DNA copy numbers of HBV or other analyses.

Recipes

  1. DNA oligo nucleotides used for the p-εRNA plasmid construction

    Sequence (5’→3’)
    Sense
    CCGGTGTACATGTCCCACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGCATGGACATTTTTG
    Antisense
    AATTCAAAAATGTCCATGCCCCAAAGCCACCCAAGGCACAGCTTGGAGGCTTGAACAGTGGGACATGTACA

Acknowledgments

This protocol, which was adapted from Sato et al. (2015), is partially based on the earlier works by Sato et al. (2012) and Sugiyama et al. (2006). This was supported by a grant from the Ministry of Education, Culture, Sports, Science and Technology of Japan (Grant-in-Aid for Scientific Research [A] [25253030] to A.T., Grant-in-Aid for Scientific Research on Innovative Areas [25115502, 23112701] to A.T., Grant-in-Aid for Young Scientists [B] [25870015] to S.S.).

Reference

  1. Bartenschlager, R. and Schaller, H. (1992). Hepadnaviral assembly is initiated by polymerase binding to the encapsidation signal in the viral RNA genome. EMBO J 11(9): 3413-3420.
  2. Sato, S., Li, K., Kameyama, T., Hayashi, T., Ishida, Y., Murakami, S., Watanabe, T., Iijima, S., Sakurai, Y., Watashi, K., Tsutsumi, S., Sato, Y., Akita, H., Wakita, T., Rice, C. M., Harashima, H., Kohara, M., Tanaka, Y. and Takaoka, A. (2015). The RNA sensor RIG-I dually functions as an innate sensor and direct antiviral factor for hepatitis B virus. Immunity 42(1): 123-132.
  3. Sato, Y., Hatakeyama, H., Sakurai, Y., Hyodo, M., Akita, H. and Harashima, H. (2012). A pH-sensitive cationic lipid facilitates the delivery of liposomal siRNA and gene silencing activity in vitro and in vivo. J Control Release 163(3): 267-276.
  4. Sugiyama, M., Tanaka, Y., Kato, T., Orito, E., Ito, K., Acharya, S. K., Gish, R. G., Kramvis, A., Shimada, T., Izumi, N., Kaito, M., Miyakawa, Y. and Mizokami, M. (2006). Influence of hepatitis B virus genotypes on the intra- and extracellular expression of viral DNA and antigens. Hepatology 44(4): 915-924.




How to cite this protocol: Sato, S., Li, K. and Takaoka, A. (2016). Infection of Human Hepatocyte-Chimeric Mice with HBV and in vivo Treatment with εRNA. Bio-protocol 6(2): e1718. DOI: 10.21769/BioProtoc.1718; Full Text



Share Your Feedback:

  • Add Photo
  • Add Video

Bio-protocol's major goal is to make reproducing an experiment an easier task. If you have used this protocol, it would be great if you could share your experience by leaving some comments, uploading images or even sharing some videos. Please login to post your feedback.

Q&A and Troubleshooting:

  • Add Photo
  • Add Video

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.


Login | Register
How to cite
Share
Twitter Twitter
LinkedIn LinkedIn
Google+ Google+
Facebook Facebook